Stu's Weblog, Stuart Robinson's blog on technology, economics, society and media.
Technology, economics, society and media.
Stuart Robinson
Mail: stublog at copywrong.org
Calendar
| ← | May | → | ||||
|---|---|---|---|---|---|---|
| Sun | Mon | Tue | Wed | Thu | Fri | Sat |
| 1 | 2 | 3 | ||||
| 4 | 5 | 6 | 7 | 8 | 9 | 10 |
| 11 | 12 | 13 | 14 | 15 | 16 | 17 |
| 18 | 19 | 20 | 21 | 22 | 23 | 24 |
| 25 | 26 | 27 | 28 | 29 | 30 | 31 |
| 2003 | |||
|---|---|---|---|
| Jan | Feb | Mar | Apr |
| May | Jun | Jul | Aug |
| Sep | Oct | Nov | Dec |
Blogroll
Thu, 01 May 2003
Today’s head fuck: being able to download the sequenced SARS genome.
ATATTAGGTTTTTACCTACCCAGGAAAAGCCAACCAACCTCGATCTCTTG
TAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTAGCTGTCGCTCGGC
TGCATGCCTAGTGCACCTACGCAGTATAAACAATAATAAATTTTACTGTC
GTTGACAAGAAACGAGTAACTCGTCCCTCTTCTGCAGACTGCTTACGGTT
[/technology] posted at 20:36 #
Looks like Iran could be the first country to geek it to freedom.
… the underlying Catch-22 here. Bloggers are under the radar of the hard-liners, and that gives them unprecedented freedom. Losing a prominent voice like Motallebi’s is a blow to the community, but losing Net access would be an even more devastating blow. So while bloggers are asking for his release, they hope for the attention of human rights groups, the mainstream press and objective voices — not the saber-rattling of some ideologues.
Jarvis for one, envisions a future without fear. “Eventually, all but the most Stone Age governments will have to let the Internet in because it has become the price of doing business in the world, and with it comes access to information and the ability to publish to the world (at no cost, with no expertise). The tools of publishing and broadcasting are coming into the hands of the people, and that will make a difference in the world.”
Preach it!