Stu's Weblog
   


Stu's Weblog, Stuart Robinson's blog on technology, economics, society and media. Technology, economics, society and media.

Stuart Robinson
Mail: stublog at copywrong.org

RSS v0.9x Feed


Calendar
←July→
Sun Mon Tue Wed Thu Fri Sat
   
15
   

2003
Jul


Blogroll

  • Brad DeLong
  • Danny O’Brien
  • BoingBoing
  • Ben Hammersley
  • John Robb
  • MPT
  • Adam Curry
  • Doc_Searls
  • Phil Windley
  • Joel
  • Lessig
  • jwz
  • Aaron_Swartz
  • Where is Raed ?
  • D-Squared

  •        
    Mon, 14 Jul 2003

    GPS keeps on coming

    Fast Company on the huge efficiency gains GPS is going to bring.

    Struggling to imagine possible uses?

    Qualcomm, which supplies satellite tracking and messaging services to 300,000 trucks across North America, is testing GPS truck-trailer locks that would allow cargo to be unloaded only at the correct location. Qualcomm routinely fields inquiries from people wanting to use GPS in new ways. A plasma-screen TV manufacturer wanted to install GPS tracking in each screen as an antitheft measure. A cattle rancher wanted GPS collars for his cows. Two school districts in Pennsylvania with GPS-equipped buses offer families an alert when the school bus is approaching, a system dubbed “Here Comes the Bus.”

    Even farming won’t escape this revolution (although subsidies will slow adoption):

    The Glenns got another surprise. Matching the fertilizer map with the next year’s harvest map, they saw that weak areas of fields aren’t helped much by fertilizer. But strong areas produce even more strongly with extra fertilizer. “We’ve cut our nitrogen use by 10% to 12% in the last few years, with the same yields or better,” Don says.

    “And that’s environmentally friendly,” says Brian.

    “And we’ve saved $5,000 or $6,000 in nitrogen costs, just on corn,” Don says. With their iPAQs, the Glenns use GPS the same way that the concrete companies do. Data gathered during the day — automatically, instead of scribbled in notebooks — is loaded into computers at sundown. Don now keeps track of how much every seed and drop of pesticide costs for every field, as well as how much the harvest brings — and he can easily call up a P&L statement on his laptop for every field.

    The present may be looked back on as the time of the blind organisation.

    [/technology] posted at 10:19 #

    Sun, 13 Jul 2003

    AOL Journals - some history

    Washington Post piece on AOL’s plans to bring blogging to their masses.

    AOL will give members three ways to update their blogs — through an online template with blank boxes for text input, through AOL’s instant-messaging system or by telephone. The phone option will be available only to subscribers to the extra-cost “AOL by Phone” service, who will be able to leave voice messages that will be posted as MP3 sound files.

    The blogosphere is self-filtering and so should only be strengthened by more participants, but many probably expected Usenet to handle a similar influx without problems 10 years ago. It did not.

    [/technology] posted at 17:05 #

    Fri, 11 Jul 2003

    Dashboard - GNOME’s desktop agent

    Ximian’s Nat Friedman is hacking up something extremely cool, Dashboard.

    Here’s a sample scenario:

    1. In an IM conversation with someone, they ask you about some project you’ve been working on.
    2. The dashboard notices what you’re talking about and matches your latest design document for the project.
    3. You say to your friend: “Check out my current design.” and drag and drop the document from the dashboard onto your IM window.
    4. Gaim transfers the file to the other person.

    Many of the required components for the above to happen are ready. Nat is receiving a lot of support and progress seems very swift.

    Check out the screenshots of it integrating with (patched) versions of Evolution (email), Gaim (instant messaging), X-Chat (IRC) and Straw (RSS news reader).

    Nat brings up a good point about the feasibility of this kind of cross-app desktop communication.

    One important thing to realize is that it would never be possible to write something like the dashboard in a world where you can’t get the source code to your applications. This is the whole “basis for innovation” thing we’re always talking about.

    And some say there is no innovation in open source applications.

    Update:

    IRC log of Dashboard demo at OSCON.

    nat looks forward to doing some specialised backends for programmers

    That sounds very interesting. Context-sensitive help in any development environment.

    [/technology] posted at 17:15 #

    The quickest way to send 2.8 terrabytes of data

    Jim Gray, head of Microsoft’s Bay Area Research Center, calls his method TeraScale SneakerNet.

    DP Are you sending them a whole PC?

    JG Yes, an Athlon with a Gigabit Ethernet interface, a gigabyte of RAM, and seven 300-GB disks - all for about $3,000.

    DP How do you get to the 7-megabytes-per-second figure?

    JG UPS takes 24 hours, and 9 hours at each end to do the copy.

    [/technology] posted at 16:28 #

    Wed, 09 Jul 2003

    No RFID for Wal-Mart, for now

    Wal-Mart cancel RFID trial. By dramatically reducing demand and thereby keeping per-unit cost high, this could significantly slow the adoption of RFID. No need to microwave your new clothes for a little while longer.

    Wal-Mart Stores has unexpectedly canceled testing for an experimental wireless inventory control system, ending one of the first and most closely watched efforts to bring controversial radio frequency identification technology to store shelves in the United States.

    [/technology] posted at 23:48 #

    Estonia high tech

    After reading this Estonia has jumped up high on my ‘good places to hibernate in “low-cash” mode’ list.

    Estonians do 80 percent of their banking on the Internet, while businessmen habitually negotiate and close deals by firing text messages to each other’s cellphones. Farmers are ordering broadband lines, and motorists on rural roads frequently pass blue information signs pointing them to the nearest place to access the Web.

    Inside Tallinn’s medieval parliament and prime minister’s offices, cabinet ministers and legislators have gone completely virtual, conducting meetings, votes, and document reviews on their networked flat-screen computers.

    “We’re the first paperless government,” says former Prime Minister Mart Laar, from the entrance to the courtyard of his old office.

    In 2000, the parliament, perhaps inspired by their new gizmos, passed a law declaring Internet access a fundamental human right of its citizenry.

    [/technology] posted at 23:48 #

    Mon, 07 Jul 2003

    More Google Weblogs

    Good piece from the NYTimes containing some example uses of internal blogging. Of particular interest this about is Google:

    Google, the provider of Internet search services, has become a big user of blogs for communication among its employees and managers - a result of the company’s acquisition of Pyra Labs, the creator of the Blogger Web log service, earlier this year. On one internal blog, called Google Love Notes, the customer service staff posts thank-you notes from users. One is from a woman who nursed her sick dog back to health after researching the illness on Google; the posting includes a photograph of the healed dog frolicking in a stream. Another came from a woman who was able to find a long-lost love through Google - and who happily reports that she wound up agreeing to marry the man’s brother.

    “It’s a good pick-me-up,” Jason Shellen, a Blogger manager at Google, said of Love Notes.

    [/technology] posted at 22:29 #

    Phones with software defined radio due Q4 2004

    CNET have a piece on Chip designers Sandbridge, who appear to be close to releasing software defined radio chips.

    The White Plains, N.Y.-based company will begin shipping the chips this year to handset makers, and the first “world phones” will appear by the end of 2004, according to Sandbridge spokesman Jeffrey Schwartz.

    “That’s three to five years ahead of what people thought,” he said.

    No joking.

    via gizmodo

    [/technology] posted at 13:21 #

    Sun, 06 Jul 2003

    Microsoft Apps on Linux

    One of the most interesting spread bets around is still open.

    USA TODAY: Is there a scenario by which you would at some point consider porting Microsoft applications into Linux?

    BG (Bill Gates): There’s no consideration of that at this point.

    [/technology] posted at 00:33 #

    Thu, 26 Jun 2003

    802.11i

    802.11i is the spec designed to beef up security for Wi-Fi.

    Why is this interesting? Because according to Wi-Fi Networking News:

    The last piece to deal with is to “agree on solution for secure fast roaming to support voice applications.”

    So that’s encrypted roaming VoIP over Wi-Fi, due May 2004. The drum beat gets louder.

    [/technology] posted at 15:49 #

    Open Source in the developing world

    It’s a pleasant surprise to see MSNBC (via Newsweek) laying into one of their proprietors so harshly, but it needs to be said.

    After the South African government threw its support behind the open-source movement last year, Microsoft offered to supply free software to government-run schools in South Africa. Hilton Theunissen, the project manager at Nooitgedacht Primary School, is skeptical of Microsoft’s sudden altruism. “For years and years I was writing letters to Microsoft, always asking for software donations,” he says. “What I ended up receiving was either a negative reply or no reply at all.”

    Microsoft is behaving like a crack dealer.

    [/technology] posted at 14:09 #

    Wed, 25 Jun 2003

    Another Westminster blog

    Richard Allan is the second UK MP to have a weblog (that I’m aware of).

    I just bumped into Tom Watson MP in the corridors of the House of Commons and we greeted each other for the first time in the real world! Funny business this that we have exchanged comments through our blogs but never spoken to each other before.

    [/technology] posted at 21:20 #

    Mon, 23 Jun 2003

    Tim O’Reilly thinks a lot

    Thanks to a (hopefully not too impressionist) “Impressionistic transcript” from Cory Doctorow, we can sample Tim O’Reilly’s incredible brain dump at Reboot:

    We’re in the middle of another paradigm shift:

    Linux critic: Linux isn’t user-friendly

    Linux geek: Linux will be better in the next rev

    They’re both wrong: the apps that run on Linux are Google,
    Amazon, etc. Not shrinkwrapped apps, but new platforms.

    Platforms made a lot more financially viable, precisely because they run on free software and commodity hardware.

    This ties up with Jason Pellerin’s point that LAMP is a saviour much more than Mozilla.

    Shirky’s “Listening to Napster:” You can build a big database by:

    1. Paying people (Yahoo)

    2. Getting volunteers (DMOZ)

    3. Architect the system so that users’ natural activity yeilds a
    database (Napster)

    That’s the secret of what’s happening on the Internet today.
    Every time you make a link, you contribute to Google. Amazon
    reviewers improve Amazon. This outstrips OSS projects for
    collaboration.

    There’s so much innovation still coming up in the use of networks. Today, no-one really understands how to use a networked computer.

    What keeps me up at night?
    • No one in OSS seems to care about Google/Amazon/eBay (I told
      Bezos off for pissing in the well when he sued BN.com)
    • Users don’t own their data — who cares about source when your
      data is locked in?

    O’Reilly implies a solution for the first: Don’t abuse the excess IP protection offered by bribed legislatures, stick to open innovation. He addresses the second in more depth here.

    I’d also suggest state mandated exportability of personal data from all applications, web or desktop… but I hear people don’t like that sort of thing. The market will get there alone, but being nudged toward the eventual - more open - compromise would help everyone.

    [/technology] posted at 16:01 #

    Sat, 21 Jun 2003

    Zero Knowledge

    Ever wondered what happened to Zero Knowledge, the 1997 Canadian start-up with a board of advisors featuring Lawrence Lessig and Bruce “Blowfish” Schneier? They lured Mozilla’s Mike Shaver away at the peak of the boom to build ”’Freedom’ technology … provides pseudonyms, encryption, and an anonymizing network to protect privacy online”.

    Well, they survived the crash, but only by selling antivirus/firewall/popup-block boredom to customers and privacy policy management packages to business.

    Now the happier part, ‘Freedom’ now does provide the encrypted anonymous web surfing service expected, after dropping cross OS support and being renamed to ‘Freedom WebSecure’. $60/month. Check out the ‘rave reviews’.

    [/technology] posted at 22:30 #

    Fri, 20 Jun 2003

    Blogging not on the radar for most CIOs

    John Patrick (former IBM chief dreamer) reports that the CIOs he’s met “… think they need blogging like they need a hole in the head”.

    During the past week, I had the pleasure of meeting with quite a few senior executives — mostly CIO’s — of major corporations. They were all familiar to varying degrees with WiFi but not one had even heard of blogging. One said, “blobbing?”.

    Once I explain what blogging is all about, the typical response from people is that they are already in “information overload” to how could they possibly take on reading or writing a blog?

    via Due Diligence

    [/technology] posted at 22:47 #

    A TiVo for daily life

    Here’s something I will be loving once it is a more mature (and discrete!) technology. The equivalent of a TiVo for your daily life. Glimpses and glances will become solid referenced memories.

    Mini-camera mounted on glasses

    Once you get enough capacity to store the whole day and some kind of AI that can intelligently process the data, things start to get very interesting.

    If that sounds far fetched, bear in mind that it’s a subset of DARPA’s LifeLog. The whole project also includes recording audio and positioning data.

    [/technology] posted at 09:22 #

    Wed, 18 Jun 2003

    Kickstarting WiFi demand

    Glenn Fleishman has a viable theory as to what will kick-start WiFi demand.

    … the catalyst for widescale uptake in hot spot network subscriptions is that 25 of the top 35 airports in the US will offer substantial Wi-Fi service throughout their terminals. The minute a business traveler truly understands that in the majority of their travels, for a flat rate of $30 to $50 per month (depending on operator), they can have unlimited access, then the wall falls down, and the customer base surges.

    [/technology] posted at 11:31 #

    Gates backs Mesh WiFi

    Here’s a surprise. Bill Gates has come out saying he expects mesh WiFi to provide universal broadband access and replace cell networks for many.

    I need to recalibrate my pie-in-the-sky-ometer.

    [/technology] posted at 11:31 #

    Sat, 14 Jun 2003

    Browser developments

    Microsoft conceed the Mac browser market to Apple:

    “The feedback we’re getting from our customers and the features they’re asking for is all pointing to Apple and Safari,” said Sommer. “Apple has better resources because they have Safari and the operating system.”

    Sommer is Jessica Sommer, Product Manager for Microsoft’s Macintosh Business Unit.

    Meanwhile, Mozilla (Firebird) is now so good even former ‘softie Joel Spolsky has switched to it.

    There was a time when Microsoft looked set to use ISS and IE to remake the web in their proprietory image. That time is over. HTML and HTTP are staying open. Mozilla and Apache need more respect for that.

    The battle now starts over the next layer of abstraction.

    [/technology] posted at 10:19 #

    Gentle Moderation

    Proof that there’s plenty of innovation left to come even in areas of the web
    that seem mature. Sam Ruby has invented a gentle form of discussion moderation. Any flamebait in his comment section is struck through and linked to a page explaining why.

    At the moment, the best solution I have come up with is to mark up the portions I find objectionable with links to this page. No words are added, deleted, or rearranged in the process.

    Mark Pilgrim has also adopted the technique and provides a more eloquent description than I can.

    I will annotate comments, and portions of comments, that I feel are personal attacks against me or others. Such flames will be marked as deleted and linked to this page.

    This is an idea built on the assumptions of hyperlinking and text styling. I’m watching with interest.

    [/technology] posted at 08:41 #

    Fri, 13 Jun 2003

    Having others do your RSS research for you

    Articles titled “How to consume RSS safely?” are useful when your dissertation project is all about RSS, but somehow this has been turned into ammunition for yet another RSS flame war.

    Weak analogy: conducting flame wars over multiple blogs (and their comments) is guerilla warfare. Trench warfare like flaming still exists on mailing-lists/discussion-boards. This is progress of sorts.

    [/technology] posted at 11:08 #

    Cell biology related to distributed computing

    Something ingenious I missed the first time via, uh, Sam Ruby.

    If you sort biological organisms by size, you will see a point at which the strategy shifts from making larger cells to making more cells. Cells are surrounded by a trust boundary. Cells communicate by two basic mechanisms.

    In the first mechanism, the sender determines the action to be taken. The request penetrates the membrane and then employs the machinery within the cell to execute per the instructions contained within the message.

    In the second mechanism, the receiver determines the action to be taken. The request matches a receptacle on the membrane and the cell uses this information to trigger biological processes.

    In biological terms, the agent of the first mechanism is called a virus, and the agent of the second mechanism is called a hormone. In larger organisms, there is a strong preference for the second mechanism.

    [/technology] posted at 11:07 #

    Tue, 10 Jun 2003

    Auto DJ software I can’t use

    Ask the DJ is an idea I’ve had before but assumed would be difficult to implement. It’s iTunes/MacOS-X only - hence the title - and so I still don’t know how difficult it would be to do well.

    Unlike any other software, Ask the DJ analyses beats to perform truly seamless transitions between tracks. Like a real DJ, it matches beats and adapts tempos whenever needed so the music always flows, even when cross-fading between tracks with different bpms.

    Linux needs a media framework as inviting to developers as iTunes seems to be. Researchless, XMMS or Gstreamer come to mind as possible contenders.

    [/technology] posted at 18:44 #

    Mon, 09 Jun 2003

    Visual babelfish

    Nice to see progress on the visual/text babelfish coming along nicely. When finished I want this overlaid in real-time on my glasses.

    Researchers in Hewlett-Packard’s labs have developed their own method of pairing a digital camera and computing device to translate signs and text in a foreign language back into English. The technology, a software applet running on an Hewlett-Packard iPaq PDA, will hopefully form the foundation for an eventual product, researchers said.

    via gizmodo

    [/technology] posted at 21:35 #

    Sat, 07 Jun 2003

    Slammer Worm debrief

    Wired’s Slammer Worm debrief is worth checking out for the awesome graphics courtesy of Akamai and Paul Boutin’s ability to evoke an image of a dying internet:

    By 12:45 am, huge sections of the Internet began to wink out of existence. Net Access Corporation, one of the Northeast’s largest ISPs, sent out an early SOS: “Nearly half our ports are in delta alarm right now.” Up on the big screen, Maresh could see backbone carrier Level 3’s transcontinental chain of routers trying to find working paths to the rest of the world - and failing. Three hundred thousand cable modems in Portugal went dark, and South Korea fell right off the map: no cell phone or Internet service for 27 million people. Five of the Internet’s 13 root-name servers - hardened systems, all - succumbed to the squall of packets.

    [/technology] posted at 13:31 #

    ESR gets worse

    NTK have been doing a good job recently of covering the excesses of (Open Source uberpimp turned political zealot) Eric Raymond.

    Their latest reveals him abusing his maintainership of the Jargon File to promote his own NeoCon agenda.

    Repeated reading of a second-hand copy of ‘The Hacker’s Dictionary’ (the print edition of the Jargon File) was my introduction to the world of computing, so I have a strong desire to see it properly maintained.

    Fortunately, the File is in the public domain, so:

    … if someone did want to fork the Jargon File, now would be the time to do it. Raymond’s previous googlejuice at tuxedo.org has been cast to the winds. A new, reformatted and popularly linked-to upstart could quickly seize the top Google slot.

    Any takers?

    [/technology] posted at 13:31 #

    Tue, 03 Jun 2003

    Salam Pax on Baghdad’s tech recovery

    Good update on the state of technology in Baghdad from Salam Pax:

    The old state owned Internet center in Adil district has been taken over by anarchists and they are offering internet access for FREE. You just need to dial up a number, no password, no special settings. Whoever heard of anyone doing that?

    Baghdad will also be getting its first GSM network in about two weeks. A couple of thousand lines as a first step, mainly for NGOs and Administration. I think it is going to be MCI who will set this up.

    via: Due Diligence

    [/technology] posted at 10:22 #

    Sun, 01 Jun 2003

    Palm WiFi

    Palm look like they have a clue:

    The Tungsten C is Palm’s first handheld with Wi-Fi built in.

    Then show that they don’t:

    The Tungsten W is a combination phone, organizer and e-mail device and shares a similar design with the Tungsten C. Instead of a Wi-Fi radio chip built in, though, it has a GSM/GPRS (Global System for Mobile Communications/General Packet Radio Service) chip so it can access cellular networks.

    Instead of?

    [/technology] posted at 11:31 #

    Thu, 29 May 2003

    India and Germany swing to OSS

    Looks like Microsoft’s “Stop Linux at all costs” slush fund was too little to win either India:

    President A P J Abdul Kalam on Wednesday urged Indian IT professionals to develop and specialise in open source code software rather than use proprietary solutions based on systems such as Microsoft Windows.

    He said that during a discussion with Microsoft CEO Bill Gates at the Rashtrapati Bhavan a few months ago, he had discussed the issue of software security and the need to look for open source codes. “Our discussions became difficult since our views were different,” Kalam said.

    or Germany:

    The city of Munich said on Wednesday that it would switch 14,000 computers from Microsoft’s Windows operating system to rival Linux.

    The Munich decision comes as the German government is installing Linux throughout certain ministries and public institutions.

    In the northern state of Lower Saxony, 11,000 police computers will be switched from Microsoft Windows to Linux from next year, according to the interior ministry.

    This is probably just the tip of the iceberg. Maybe Gates will bankroll a internationally palatable presidential candidate in 2004.

    With thanks to my gracious hosts

    [/technology] posted at 23:08 #

    Weblogs in Organisations

    Phil Windley and Phil Wolff are asking some good questions about potential roles and details of organisational blogging.

    [/technology] posted at 23:08 #

    Wed, 28 May 2003

    Apple start to bow to the RIAA

    Cory Doctorow’s anger at Apple reminds me of another reason I use Free Software: I don’t like feeling betrayed.

    Apple has removed a useful feature from its software, and its customers are out in the cold. I paid $50 or so for downloadable iTunes tracks, with the understanding that Apple had sold me something that would stream over the Internet. Yesterday, they had. Today, they took it away. And they called it an “enhancement.” As Winston Smith said to O’Brien, “Don’t feed me shit and tell me it’s Victory Gin.”

    [/technology] posted at 01:44 #

    More thoughts on WiFi enabled phones

    I’ll keep banging the drum because the disruptive potential of WiFi/GSM phones is huge and I’m yearning for one.

    They are coming:

    Mayhew-Begg said that by the end of the year, the first Nokia phone with WiFi as well as GSM would be launched.

    Hughes said that the fears of power consumption being high on WiFi phones were unjustified. “My understanding is that the only difference in power consumption between WiFi and Bluetooth is the range. So with power control added to WiFi, you can get similar power consumption.”

    … fingers crossed.

    Voice over IP over WiFi has early adoptors outside of businesses. (Apple co-founder) Woz recently moved house just to get a GSM signal. Others would adopt for a cheap-open (if patchy) 3G equivalent, with universal remote control and point of presence as co-motivators.

    Tariff avoidance is the mass-market adoption motivator and is powerfully viral (“You have unlimited texting and landline calls from here, work and college?! How?!”). It should also drive home WiFi/broadband adoption and public hotspot demand. The market for Hotspot in a Box products should be massive.

    Winners:

    • WiFi vendors
    • Mobile phone manufacturers
    • Broadband providers
    • VoIP providers
    • Sociable people

    Losers:

    • GSM network providers
    • 3G license holders
    • Traditional landline providers

    Just another TelCo misery story.

    [/technology] posted at 00:28 #

    Mon, 26 May 2003

    A message for our less creative programmers

    Did you make a killing fixing decades old COBOL programs for Y2K? Were you planning to live off the cash, build up your Unix and C skills just in time for the fun that 2038 is sure to bring?

    Well, why wait until then?! From 2005 :

    … the Uniform Code Council (UCC) will no longer support the UPC-12 barcode standard that is almost universally used in North America. This is because the UCC, which controls company identification numbers that are part of the UPC-12 symbology is running out of numbers to fit in the 12-digit format.

    The UCC has issued a joint recommendation with its European and Japanese counterparts to fix the problem using a 14-digit standard of the same symbology.

    Quick, you still have time to swat up on Point of Sales systems!

    via Adam Curry

    [/technology] posted at 16:03 #

    Skylinc - balloon based wireless broadband for rural Britain

    It requires a directed dish so is not mobile, but it’s potential to offer 10MB/s anywhere should still shake up the broadband market.

    The BBC have a piece but Skylinc’s website is much richer on info:

    Each LIBRA super-cell has a MASSIVE coverage of 2,000 sq miles (equivalent coverage of up to 2,000 traditional wireless base stations)

    87% of UK SME business locations will be accessible from only 18 LIBRA platforms

    It looks like it was specifically developed to solve the problem of getting rural businesses online:

    SkyLINC’s product development has been funded by UK Government Department of Trade and Industry grants and private US aerospace investment.

    [/technology] posted at 15:21 #

    Sun, 25 May 2003

    Moving Google with your eyes

    I think Jeremy Zawodny is jumping the gun - he admits the possibility himself, but I like unusual adaptions of Heisenberg’s Uncertainty Principle too much for that to count against him.

    Google has a really hard problem to solve. It’s not unlike the Heisenberg Uncertainty Principle. PageRank stopped working really well when people began to understand how PageRank worked. The act of Google trying to “understand” the web caused the web itself to change.

    More Blogosphere-Gaining-Self-Awareness going on as Kalsey
    deconstructs his recent popularity.

    [/technology] posted at 14:17 #

    Thu, 22 May 2003

    The tech it took to take Baghdad

    Joshua Davis describes “a dazzling array of technology that signals the arrival of digital warfare” in his awesome Wired article on the tech it took to take Baghdad.

    Caddell sketches out a typical scenario: A Special Forces unit in northern Iraq attacks an Iraqi irregular unit. The firefight is recorded with digital video, which is uploaded to GCCS via secure satellite. JOC intelligence officers fire up the Warfighting Web, click through to “Latest Intelligence,” watch the fight, write a summary, and post follow-up orders to the unit. The soldiers either download the orders directly or receive them by radio from the nearest Tactical Operations Center, the most forward command post on the network.

    They’re using Microsoft Chat!?

    “What’s funny about using Microsoft Chat,” he adds with a sly smile, “is that everybody has to choosean icon to represent themselves. Some of these guys haven’t bothered, so the program assigns them one. We’ll be in the middle of a battle and a bunch of field artillery colonels will come online in the form of these big-breasted blondes. We’ve got a few space aliens, too.”

    How important is the network?

    Lieutenant Colonel Mims: “If it’s a question of the network going down, we get helicopters, air support, tanks - whatever we need”

    It looks slightly different from the trenches:

    There are other problems. “When we were deployed from the States,” says Lieutenant Marc Lewis - the commander of the convoy’s 27 heavy equipment trucks - “they told us that we would be given encrypted, military-issue radios when we got here. When we arrived, they told us we should have brought our own.”

    What Lewis brought was four Motorola Talkabouts, each with a range of about 1,000 feet. In the half-dozen convoy trips he’s made since arriving in country, Lewis has taken to distributing a Talkabout to the first and last trucks. The other two go to vehicles at strategic points in between. It’s hardly secure. Anybody with a radio could monitor the conversations.

    I give up, there’s too much good stuff in there to quote. Read it. Worryingly little thought seems to have gone into what happens when both sides have this kind of technology.

    And Bruce Berkowitz suggests how this can be applied to North Korea, where apparently, they are training hackers.

    [/technology] posted at 08:41 #


    Jason Pellerin faultlessly expands on my Mute/Non-Programmer idea.

    [/technology] posted at 07:53 #

    Wed, 21 May 2003

    Nokia commit to WiFi

    This is the first public commitment Nokia have made to WiFi. It’s not much but at least shows they’re not going to be blindsided.

    Donal O’Connell, Nokia phones’ R&D veep, said that WiFi will form a part of its future high-end handsets at an analyst briefing in Irvine, Texas today.

    802.11 will be an option, he told us, but just another option. That doesn’t mean that WiFi will be used for handling voice calls, however.

    I have a recent Series 60 Nokia (the 7650 - I’m very happy with it). The platform is open enough that if it had WiFi and somebody released a Voice over IP/WiFi application for it, there’s nothing Nokia would be able (or logically would want) to do. I read that last statement as an attempt to pacify the networks - who are the real losers here.

    Clay Shirky’s Permanet, Nearlynet, and Wireless Data is a good starting point for this.

    [/technology] posted at 08:49 #

    Blogs and Wikis

    I’ve been doing a fair bit of thinking about how to increase the crossover between blogs and wikis. Joi Ito started me off so he should find this interesting.

    Blog to Wiki

    Each blog post should be automatically injected into it’s own wiki page. These pages should be alterable only with the approval of the original author. Changes by anyone else would be queued for the author’s approval and automatically applied if approval is granted. This would allow corrections to be made while preserving the original historic record.

    Each weblog entry could now be accompanied with a “correct this entry” button and if appropriate a “view corrected version” button.

    The wiki page can show the author’s current (under)standing with the blog showing his original post on the subject.

    WikiWords appearing in a weblog post should be automatically converted to links to the correct wiki page.

    Wiki to Blog

    The only way I could imagine this working is to have have wiki changes presented as either part of the blog or down a sidebar. If this is a personal blog, only that person’s changes should be shown.

    The key to making this work is attractive presentation and intelligent aggregation.

    If these changes are presented in an attractive enough way, skimming should allow one to intuitively pick up the level and kind of activity occuring on the Wiki (and by extension the project). For a group blog, daily aggregation of changes, per author, may be required to reach a satisfactory level of browsability.

    These pretified changes should, of course, be offered as RSS alongside the weblog’s feed. In fact, this is a good example of an alternative use of RSS.

    [/technology] posted at 02:36 #

    Tue, 20 May 2003

    Recursive blogging

    One thing I’m learning is that no matter how much you intend not to, you end up blogging about blogging. Doing it makes total sense now, but from the outside always seemed self-obsessed.

    With that in mind, here is a piece from Microdoc news that thinks it’s own popularity is likely:

    The stories that get going are not usually subject specific blogs but stories that cut across all interests of the blogging community. A medical, technical, or other type blog does not make it big, for example. But stories about blogging, human rights, world events, or the human spirit that apply to everyone, tend to become big stories.

    There’s a lot more good stuff in there.

    [/technology] posted at 23:44 #

    Mon, 19 May 2003

    Corporate computer security consulting still sucks?

    Interesting idea from Charlie Stross.

    My experience of large consulting companies is that their analysts are more focussed on the appearance of professionalism than on the substance, more interested in looking trustworthy to the occupants of the boardroom — walking the management walk, talking the management talk — than in actually doing the job.

    Structures. Human organisations that are fundamentally defective at the job in hand but that are more successful than competent organisations in the market because they’re better at winning contracts. Predictability and security. (Is that an itch in my fingertips? I can feel a story coming on …)

    That means that the real problem lies in the companies hiring consultants. If security becomes important enough then companies will be forced to consult the competent or be hacked to death.

    “I don’t care how nice those guys are or how many meals they took us out on. If we get robbed by hackers again, I get fired. Hire the guys with the dodgy beards”.

    [/technology] posted at 15:21 #

    New wifi cards work on any frequency = no Linux drivers

    This gives us a preview of the major shitstorm that software radio is going to cause.

    [/technology] posted at 15:00 #

    South Korea: a futurologist’s wet dream

    Want to see what 70% broadband adoption does to a society?

    Korea tells you:

    But only gives you a taste of your future.

    [/technology] posted at 12:50 #

    Microsoft licenses Unix IP from SCO

    Coincidentally at the same time as SCO are suing IBM to stop Linux. Microsoft are a company capable of learning and adapting. What they learnt from the antitrust trial seems to be ‘get someone else to do your dirty work’.

    Late Sunday, Microsoft general counsel Brad Smith said acquiring the license from SCO “is representative of Microsoft’s ongoing commitment to respecting intellectual property and the IT community’s healthy exchange of IP through licensing”.

    Is he trying to imply something?

    [/technology] posted at 11:22 #

    Sun, 18 May 2003

    LifeLog, from the people who brought you ARPANET

    One good thing about having a (AWOL) fighter pilot in the White House - DARPA has a ton of money again.

    This project appears to be an attempt to create the kind of intelligence computers will need to be able to make sense of all the data of an individual’s life. The ultimate PA and PH (personal historian).

    [/technology] posted at 10:52 #

    RFID tag + mobile phone = credit card
    That IBM ad where the guy in the trenchcoat looks like he’s shoplifting but is actually paying wirelessly (hoho!) is now more than an ad.

    [/technology] posted at 09:46 #

    Sat, 17 May 2003

    WiFi phones in use

    Fortune article titled “This Is Not a Cellphone”.

    At 27 of Group Dekko’s 30 locations around the country, managers and supervisors use special handsets to make and receive voice calls on the same wireless broadband network the company uses for Internet access. The calls are converted to Internet Protocol data “packets.” They essentially travel for free as long as they stay on Group Dekko’s wireless intranet.

    So why not marry the two technologies (WiFi + GSM)? In fact, Motorola, Proxim, and Avaya are jointly developing handsets and gear that will let callers roam between the two types of wireless networks. By the end of the year the companies will begin testing phones that run voice over Wi-Fi in the office and voice over cellular on the go.

    This is what’s going to kill 3G and strip most of the profit out of being a mobile GSM network provider.

    [/technology] posted at 10:48 #

    Thu, 15 May 2003

    Apple’s backdoor napster clone

    The theory is that Apple intentionally made iTunes transparent enough that semi-legal file sharing systems could be built around it. Hopefully sidestepping legal problems.

    Apple could be the first company to understand how open, commercial and underground code can be combined to benefit their customers and their own bottom line.

    The next test comes when the Apple have to decide how to deal with iTunes clones and unofficial iTunes Music Store clients. If they wield the DMCA they will lose the faith of many.

    [/technology] posted at 10:02 #

    Wed, 14 May 2003

    Romero developing for the N-Gage

    Slashdot brings news from E3 that Doom and Quake co-creator John Romero is developing for Nokia’s new gaming oriented phone.

    In the long term the mobile phone will destroy the Gameboy, and with Sony looking to enter this market, Nintendo should be looking for a new revenue stream.

    [/technology] posted at 10:39 #

    IT goes golden or grey?

    Interesting Economist article about IT leaving it’s exponential roots behind and ‘just working’. I read somewhere that this is actually regurgitated Oracle PR but I’m a sucker for slick historic parallels, so:

    When Britain’s railway mania collapsed in 1847, railroad shares plunged by 85%, and hundreds of businesses went belly-up. But train traffic in Britain levelled off only briefly, and in the following two decades grew by 400%.

    Brad DeLong, an economics professor at the University of California at Berkeley, puts it somewhat more succinctly: “I am optimistic about technology, but not about profits.”

    [/technology] posted at 07:26 #

    Mon, 12 May 2003

    Sub-City Tunnelling

    Here’s something from last month’s Wired that I missed. The emergence of tunnelling technologies that appear to make underground suburbs (underburbs?) economically inevitable.

    You won’t hear much talk of it outside of specialized engineering circles, but we’re at a tipping point. The cost to burrow down is dropping, while the price (and hassle) of erecting a skyscraper in a dense urban area just keeps rising. The breakthrough comes thanks to tunneling technologies that are now being used on huge transportation projects, like Boston’s Big Dig and Moscow’s Lefortovo highway tunnel project. Over the next 10 years these techniques will be used to hollow out space beneath the world’s great cities.

    [/technology] posted at 17:46 #

    Stanford’s 1k page/hr book scanning robot

    Fantastic milestone on the way to universal digitisation of the world’s knowledge.

    For Mr. Keller the most vexing challenges are neither labor costs nor technology. Librarians, he said, must find a way to address the copyright restrictions that appear to be tightening as a result of new federal laws like the Digital Millennium Copyright Act of 1998.

    And people wonder why there are so many libertarians on the Internet.

    Another project, led by the Internet Archive in San Francisco, recently shipped 80 tons of old books acquired from the Kansas City Library to Hyderabad, India, where they will be scanned, according to Michael Lesk, a former National Science Foundation official and digital library expert who works with the archive.

    Excellent.

    [/technology] posted at 14:00 #

    Wed, 07 May 2003

    Decentralised security camera watching

    Another sighting of the transparent society on the horizon.

    [/technology] posted at 11:05 #

    Thu, 01 May 2003

    SARS 1.0 Released

    Today’s head fuck: being able to download the sequenced SARS genome.

    ATATTAGGTTTTTACCTACCCAGGAAAAGCCAACCAACCTCGATCTCTTG
    TAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTAGCTGTCGCTCGGC
    TGCATGCCTAGTGCACCTACGCAGTATAAACAATAATAAATTTTACTGTC
    GTTGACAAGAAACGAGTAACTCGTCCCTCTTCTGCAGACTGCTTACGGTT

    [/technology] posted at 20:36 #

    Sun, 19 Jan 2003

    Open Code and Free Speech

    I use almost exclusively open source software. There are many reason for this, the most important being my intolerance of unjustified crapiness (if my computer is pissing me off I want an excuse and a solution).

    Another major advantage of open code is the ability to audit the code. Now you can check that, for example, your computer is not CCing your emails to the FBI or your plan(s) for world domination to Bill Gates. Except that unless you’re a programmer, you won’t understand the code and therefore you can’t.

    So where is the benefit for non-programmers? A slightly bizarre comparision I like is to a mute man choosing which country he should claim asylum in. He can’t speak so what use is freedom of speech to him? Others will speak for him, helping to ensure his liberty. Others will audit code for you, helping to ensure your security.

    [/technology] posted at 14:41 #

    Wed, 15 Jan 2003

    The dragon and the crack screen

    While wandering around other bloggers archives - in a vain (as in unsuccessful) attempt to find others struggling, as I am, to find their writing feet - I ran across the wonderful first article of Mark Pilgrim.

    It contains the following beautiful and ironic observation:

    Sonys and Broderbunds of the world, pay attention: the only long-term effect of copy protection is to ensure that those who defeat it are immortalized. Long after my Playstation console falls apart, long after all the original, legitimate, uncopyable Playstation discs have crumbled into dust, long after the no-doubt-teenager who cracked Spyro 3 has grown up and joined polite society and found better things to do with his time, Spyro the Dragon will be remembered. Unfortunately, it will also be associated with that damn ugly crack screen, because no other versions will exist. This is what the past will look like someday. And we’ll just shrug, skip intro, and get on with it.

    [/technology] posted at 21:09 #

    Tue, 14 Jan 2003

    Annotation, the Bible and the public domain

    The use of hypertext in centralised, non-intrusive annotation projects is a very valuable one. It is also something that clearly demonstrates the value of a large and digital public domain. Annotated hard-copy is, in comparison, slow, clumsy and limited in it’s uses.

    The Skeptics Bible is a project that makes use of hypertext in exactly this way. Its focus on one specific document makes it different to most other annotation projects.

    While writing this is has become obvious to me that weblogs are a decentralised citation system. What would a map of social software, with x-axis as citation-annotation and y-axis (de)centralisation look like?

    [/technology] posted at 10:18 #