Stu's Weblog
   


Stu's Weblog, Stuart Robinson's blog on technology, economics, society and media. Technology, economics, society and media.

Stuart Robinson
Mail: stublog at copywrong.org

RSS v0.9x Feed


Calendar
←May→
Sun Mon Tue Wed Thu Fri Sat
       

2003
May


Blogroll

  • Brad DeLong
  • Danny O’Brien
  • BoingBoing
  • Ben Hammersley
  • John Robb
  • MPT
  • Adam Curry
  • Doc_Searls
  • Phil Windley
  • Joel
  • Lessig
  • jwz
  • Aaron_Swartz
  • Where is Raed ?
  • D-Squared

  •        
    Thu, 29 May 2003

    Brief Links

    Studies of virtual worlds expand from economics to law.

    The “gaming console as razor - games as blades” model doesn’t look quite so clever when people start building super computers out of them.

    Snow Crash looking a bit too distant? Why not contribute?! Buy this and start floating it round the Pacific rim.

    WiFi chips $6.50 by Q1 2004. $4 later that year.

    [/misc] posted at 23:09 #

    China jails 4, tortures 1 for e-subversion

    Well, the Chinese government doesn’t mess around when dealing with those evil pro-democracy subversives.

    The Beijing Intermediate People’s Court sentenced geologist Jin Haike, 27, and Xu Wei, a 28-year-old journalist for Beijing’s Consumer Daily, to 10 years each in prison. Yang Zili, a 31-year-old computer engineer, and Zhang Honghai, a 29-year-old freelance writer, were each given eight years.

    One of the men sentenced on Wednesday, Xu Wei, told the court he had been brutally beaten and tortured with electric shocks to his genitals, according to campaign group Human Rights in China. The former journalist had to be carried out of the court after he struck his head on the judge’s desk and was knocked unconscious, the group said.

    [/society] posted at 23:09 #

    India and Germany swing to OSS

    Looks like Microsoft’s “Stop Linux at all costs” slush fund was too little to win either India:

    President A P J Abdul Kalam on Wednesday urged Indian IT professionals to develop and specialise in open source code software rather than use proprietary solutions based on systems such as Microsoft Windows.

    He said that during a discussion with Microsoft CEO Bill Gates at the Rashtrapati Bhavan a few months ago, he had discussed the issue of software security and the need to look for open source codes. “Our discussions became difficult since our views were different,” Kalam said.

    or Germany:

    The city of Munich said on Wednesday that it would switch 14,000 computers from Microsoft’s Windows operating system to rival Linux.

    The Munich decision comes as the German government is installing Linux throughout certain ministries and public institutions.

    In the northern state of Lower Saxony, 11,000 police computers will be switched from Microsoft Windows to Linux from next year, according to the interior ministry.

    This is probably just the tip of the iceberg. Maybe Gates will bankroll a internationally palatable presidential candidate in 2004.

    With thanks to my gracious hosts

    [/technology] posted at 23:08 #

    Weblogs in Organisations

    Phil Windley and Phil Wolff are asking some good questions about potential roles and details of organisational blogging.

    [/technology] posted at 23:08 #

    Wed, 28 May 2003

    Apple start to bow to the RIAA

    Cory Doctorow’s anger at Apple reminds me of another reason I use Free Software: I don’t like feeling betrayed.

    Apple has removed a useful feature from its software, and its customers are out in the cold. I paid $50 or so for downloadable iTunes tracks, with the understanding that Apple had sold me something that would stream over the Internet. Yesterday, they had. Today, they took it away. And they called it an “enhancement.” As Winston Smith said to O’Brien, “Don’t feed me shit and tell me it’s Victory Gin.”

    [/technology] posted at 01:44 #

    More thoughts on WiFi enabled phones

    I’ll keep banging the drum because the disruptive potential of WiFi/GSM phones is huge and I’m yearning for one.

    They are coming:

    Mayhew-Begg said that by the end of the year, the first Nokia phone with WiFi as well as GSM would be launched.

    Hughes said that the fears of power consumption being high on WiFi phones were unjustified. “My understanding is that the only difference in power consumption between WiFi and Bluetooth is the range. So with power control added to WiFi, you can get similar power consumption.”

    … fingers crossed.

    Voice over IP over WiFi has early adoptors outside of businesses. (Apple co-founder) Woz recently moved house just to get a GSM signal. Others would adopt for a cheap-open (if patchy) 3G equivalent, with universal remote control and point of presence as co-motivators.

    Tariff avoidance is the mass-market adoption motivator and is powerfully viral (“You have unlimited texting and landline calls from here, work and college?! How?!”). It should also drive home WiFi/broadband adoption and public hotspot demand. The market for Hotspot in a Box products should be massive.

    Winners:

    • WiFi vendors
    • Mobile phone manufacturers
    • Broadband providers
    • VoIP providers
    • Sociable people

    Losers:

    • GSM network providers
    • 3G license holders
    • Traditional landline providers

    Just another TelCo misery story.

    [/technology] posted at 00:28 #

    Tue, 27 May 2003

    Stanton Warriors in Oxford this Thursday

    Awesome breakbeats at PONANA: details

    [/misc] posted at 23:42 #

    Mon, 26 May 2003

    A message for our less creative programmers

    Did you make a killing fixing decades old COBOL programs for Y2K? Were you planning to live off the cash, build up your Unix and C skills just in time for the fun that 2038 is sure to bring?

    Well, why wait until then?! From 2005 :

    … the Uniform Code Council (UCC) will no longer support the UPC-12 barcode standard that is almost universally used in North America. This is because the UCC, which controls company identification numbers that are part of the UPC-12 symbology is running out of numbers to fit in the 12-digit format.

    The UCC has issued a joint recommendation with its European and Japanese counterparts to fix the problem using a 14-digit standard of the same symbology.

    Quick, you still have time to swat up on Point of Sales systems!

    via Adam Curry

    [/technology] posted at 16:03 #

    Skylinc - balloon based wireless broadband for rural Britain

    It requires a directed dish so is not mobile, but it’s potential to offer 10MB/s anywhere should still shake up the broadband market.

    The BBC have a piece but Skylinc’s website is much richer on info:

    Each LIBRA super-cell has a MASSIVE coverage of 2,000 sq miles (equivalent coverage of up to 2,000 traditional wireless base stations)

    87% of UK SME business locations will be accessible from only 18 LIBRA platforms

    It looks like it was specifically developed to solve the problem of getting rural businesses online:

    SkyLINC’s product development has been funded by UK Government Department of Trade and Industry grants and private US aerospace investment.

    [/technology] posted at 15:21 #

    Sun, 25 May 2003

    Oil Corruption

    An Economist article on how badly countries tend to handle mineral wealth and how accounting disclosure rules (“Publish What You Pay”) for big oil companies should help third world development.

    The Publish What You Pay folks look like something quite rare. Well thought out, realistic, targetted activism.

    [/society] posted at 17:33 #

    Notes on (the Politics of) Eurovision

    I’ve come to the conclusion that the Eurovision Song contest is worth watching at least once every few years, as long as you follow three rules:

    1. Skip all the songs and only tune in for the voting.
    2. Pretend the singing never even took place.
    3. Ensure someone with half-decent knowledge of European geography, history and politics is present.

    Most of the songs are so bad that and the public’s bias so strong that the only way to explain much of the voting is in the context of political history. This is widely discussed inside of Europe but is probably missed by those looking in.

    Time have an article from last year:

    This “is the continuation of European wars by peaceful means,” says Jurgen Meier-Beer of Germany, who is on the committee overseeing the show.

    Gilles Renault, music critic for Liberation. “It’s more of a joke than anything else.” Britain, at least, knows to laugh. In fact, people throw parties to enjoy what Terry Wogan calls “sublime awfulness.”

    There is also a more comprehensive statistical analysis:

    … voting patterns tended to break down into three blocs: a Western Bloc (England, Ireland, France, Holland, Belgium and Luxembourg), a Northern Bloc (the Scandinavian countries plus Germany) and a Mediterranean Bloc (Turkey, Italy, Spain, Yugoslavia, Greece and Cyprus.) Each was far more likely to vote for countries within its bloc than for those outside it. And as a rule of thumb, the further away countries are, the less likely they are to give each other points.

    If you get bored of watching it from this perspective you can also consider the possibility of bribery and which countries would care enough - about the potential positive PR - to do it.

    [/society] posted at 14:18 #

    Moving Google with your eyes

    I think Jeremy Zawodny is jumping the gun - he admits the possibility himself, but I like unusual adaptions of Heisenberg’s Uncertainty Principle too much for that to count against him.

    Google has a really hard problem to solve. It’s not unlike the Heisenberg Uncertainty Principle. PageRank stopped working really well when people began to understand how PageRank worked. The act of Google trying to “understand” the web caused the web itself to change.

    More Blogosphere-Gaining-Self-Awareness going on as Kalsey
    deconstructs his recent popularity.

    [/technology] posted at 14:17 #

    More open content

    Free (although very experimental) music over at Opsound.

    This is via an interesting article over at Creative Commons to promote alternate copyright licenses.

    I’m listening to this right now and it’s ambient city noise. Literally. It could be relaxing.

    [/misc] posted at 00:28 #

    Sat, 24 May 2003

    Useless trivia from museums #1 - Oxford Museum of Science

    The Oxford Museum of Science currently have a “Horological Masterworks” exhibition from which I learnt about Roman Striking clocks.

    These are ingenious devices which can produce 3 different sounds, each sound representing X, V or I. This allows the clock to chime the hour in Roman Numerals. They can be visually identified because they use IV as 4 instead of the near universal (for clocks) IIII.

    [/misc] posted at 13:57 #

    Thu, 22 May 2003

    The tech it took to take Baghdad

    Joshua Davis describes “a dazzling array of technology that signals the arrival of digital warfare” in his awesome Wired article on the tech it took to take Baghdad.

    Caddell sketches out a typical scenario: A Special Forces unit in northern Iraq attacks an Iraqi irregular unit. The firefight is recorded with digital video, which is uploaded to GCCS via secure satellite. JOC intelligence officers fire up the Warfighting Web, click through to “Latest Intelligence,” watch the fight, write a summary, and post follow-up orders to the unit. The soldiers either download the orders directly or receive them by radio from the nearest Tactical Operations Center, the most forward command post on the network.

    They’re using Microsoft Chat!?

    “What’s funny about using Microsoft Chat,” he adds with a sly smile, “is that everybody has to choosean icon to represent themselves. Some of these guys haven’t bothered, so the program assigns them one. We’ll be in the middle of a battle and a bunch of field artillery colonels will come online in the form of these big-breasted blondes. We’ve got a few space aliens, too.”

    How important is the network?

    Lieutenant Colonel Mims: “If it’s a question of the network going down, we get helicopters, air support, tanks - whatever we need”

    It looks slightly different from the trenches:

    There are other problems. “When we were deployed from the States,” says Lieutenant Marc Lewis - the commander of the convoy’s 27 heavy equipment trucks - “they told us that we would be given encrypted, military-issue radios when we got here. When we arrived, they told us we should have brought our own.”

    What Lewis brought was four Motorola Talkabouts, each with a range of about 1,000 feet. In the half-dozen convoy trips he’s made since arriving in country, Lewis has taken to distributing a Talkabout to the first and last trucks. The other two go to vehicles at strategic points in between. It’s hardly secure. Anybody with a radio could monitor the conversations.

    I give up, there’s too much good stuff in there to quote. Read it. Worryingly little thought seems to have gone into what happens when both sides have this kind of technology.

    And Bruce Berkowitz suggests how this can be applied to North Korea, where apparently, they are training hackers.

    [/technology] posted at 08:41 #


    Jason Pellerin faultlessly expands on my Mute/Non-Programmer idea.

    [/technology] posted at 07:53 #

    Iraqi Debt Write Off

    Here’s a good idea from an Economist article about Iraqi debt. Writing off the debt of deposed dictatorships will discourage lending to active ones.

    Some economists, such as Michael Kremer of Harvard University, argue that, after a change of regime, a country’s new government should have no legal obligation to service the “odious debt” of an illegitimate predecessor, an idea dating back to the Spanish-American war of 1898. In theory, establishing the right of a country to write off odious debt would have potentially huge benefits, not least by discouraging banks from lending to nasty governments that might one day be overthrown. Indeed, says Mr Kremer, setting out precise rules for what counts as an “odious regime”, and thereby making it harder for such regimes to borrow, may be a better form of economic sanction than the traditional approach of obstructing trade. Restrictions on trade hurt ordinary people, whereas making it harder to borrow hurts the baddies in charge more directly.

    However:

    As Harold James, another Princeton economist, has argued, this could destabilise the global credit markets by making creditors fearful that other countries might one day describe their debt as odious. It is not hard to imagine circumstances in which, say, a newly democratic China might try to shed the external debt “$170 billion at the end of 2001” of the “odious” undemocratic regime it replaced.

    Still, in the UK, memories of the dodgy arms deals bailed out by the ECGD make me hope it could work.

    [/economics] posted at 06:23 #

    Wed, 21 May 2003

    Labour MP has weblog, will flame

    Labour MP Tom Watson has a weblog and is using it to lay into Tory opponent Bill Cash MP, whose politically sensitive mobile phone conversation he overheard on a Monday morning train.

    Cash retorts in The Mirror:

    “If people are listening in to other people’s conversations - and in my view misinterpreting them - then I think that’s a very great shame.”

    Which annoys Watson:

    No, no, no Mr Cash you can not get away with that. You know I didn’t misinterpret anything. Continue down this road and I will have to reveal the rest of the conversations we all had to endure. In fact I might do anyway.…..

    If this is anything to go by, the next election is going to be fun.

    [/society] posted at 10:37 #

    Nokia commit to WiFi

    This is the first public commitment Nokia have made to WiFi. It’s not much but at least shows they’re not going to be blindsided.

    Donal O’Connell, Nokia phones’ R&D veep, said that WiFi will form a part of its future high-end handsets at an analyst briefing in Irvine, Texas today.

    802.11 will be an option, he told us, but just another option. That doesn’t mean that WiFi will be used for handling voice calls, however.

    I have a recent Series 60 Nokia (the 7650 - I’m very happy with it). The platform is open enough that if it had WiFi and somebody released a Voice over IP/WiFi application for it, there’s nothing Nokia would be able (or logically would want) to do. I read that last statement as an attempt to pacify the networks - who are the real losers here.

    Clay Shirky’s Permanet, Nearlynet, and Wireless Data is a good starting point for this.

    [/technology] posted at 08:49 #

    Blogs and Wikis

    I’ve been doing a fair bit of thinking about how to increase the crossover between blogs and wikis. Joi Ito started me off so he should find this interesting.

    Blog to Wiki

    Each blog post should be automatically injected into it’s own wiki page. These pages should be alterable only with the approval of the original author. Changes by anyone else would be queued for the author’s approval and automatically applied if approval is granted. This would allow corrections to be made while preserving the original historic record.

    Each weblog entry could now be accompanied with a “correct this entry” button and if appropriate a “view corrected version” button.

    The wiki page can show the author’s current (under)standing with the blog showing his original post on the subject.

    WikiWords appearing in a weblog post should be automatically converted to links to the correct wiki page.

    Wiki to Blog

    The only way I could imagine this working is to have have wiki changes presented as either part of the blog or down a sidebar. If this is a personal blog, only that person’s changes should be shown.

    The key to making this work is attractive presentation and intelligent aggregation.

    If these changes are presented in an attractive enough way, skimming should allow one to intuitively pick up the level and kind of activity occuring on the Wiki (and by extension the project). For a group blog, daily aggregation of changes, per author, may be required to reach a satisfactory level of browsability.

    These pretified changes should, of course, be offered as RSS alongside the weblog’s feed. In fact, this is a good example of an alternative use of RSS.

    [/technology] posted at 02:36 #

    When editors attack

    I don’t know how much of Greg Palast’s “The Best Democracy Money Can Buy” has been mutilated, but the page that I happened to open it on had “September 11, 2002” replacing “9/11”. Now I don’t have the motivation to read it, I know I’d be fact checking all the time.

    Compare:
    Page from Greg Palast's TBDMCB
    and his version.

    On my BBC television show, Newsnight, an American journalist confessed that, since the 9/11 attacks, U.S. reporters are simply too afraid to ask the uncomfortable questions that could kill careers

    [/media] posted at 01:19 #

    Heh, I’m not invisible

    Flattering to think I could make Brad Delong’s brain explode.

    Wow! My brain explodes. Not in a bad way, you understand. In a good way. Stuart Robinson (who is he?) goes live with his weblog. How can he know about so much good stuff that I have missed?

    Is quoting myself equivalent to talking to myself? :

    I’ll try to get an ‘about’ page up, the apparent anonymity is just from a lack of time. Abridged: British, based in Oxford, not at ‘Oxford’, soon to graduate. Reads too much.

    [/meta] posted at 00:34 #

    Tue, 20 May 2003

    Recursive blogging

    One thing I’m learning is that no matter how much you intend not to, you end up blogging about blogging. Doing it makes total sense now, but from the outside always seemed self-obsessed.

    With that in mind, here is a piece from Microdoc news that thinks it’s own popularity is likely:

    The stories that get going are not usually subject specific blogs but stories that cut across all interests of the blogging community. A medical, technical, or other type blog does not make it big, for example. But stories about blogging, human rights, world events, or the human spirit that apply to everyone, tend to become big stories.

    There’s a lot more good stuff in there.

    [/technology] posted at 23:44 #

    Hello

    OK, finally. After what looks (in the calendar) like an age and felt like an eternity, my weblog is live.

    I’m still not convinced choosing blosxom over Movable Type was wise. But the plugins rock and at least RMS won’t hunt me down.

    Now all that’s left to do is:

    • Learn how to write coherently
    • Produce a nice design in CSS
    • Fill up the sidebar with little hacks to make me look clever
    • Standards validation
    • RSS 1.0 and 2.0

    and I’m ready to take on the world.

    [/meta] posted at 12:13 #

    Mon, 19 May 2003

    Corporate computer security consulting still sucks?

    Interesting idea from Charlie Stross.

    My experience of large consulting companies is that their analysts are more focussed on the appearance of professionalism than on the substance, more interested in looking trustworthy to the occupants of the boardroom — walking the management walk, talking the management talk — than in actually doing the job.

    Structures. Human organisations that are fundamentally defective at the job in hand but that are more successful than competent organisations in the market because they’re better at winning contracts. Predictability and security. (Is that an itch in my fingertips? I can feel a story coming on …)

    That means that the real problem lies in the companies hiring consultants. If security becomes important enough then companies will be forced to consult the competent or be hacked to death.

    “I don’t care how nice those guys are or how many meals they took us out on. If we get robbed by hackers again, I get fired. Hire the guys with the dodgy beards”.

    [/technology] posted at 15:21 #

    EasyCinema

    EasyJet’s Stelios Haji-Ioannou pushes his yield management techniques into the cinema industry:

    It’s a novel system because it depends on the price incentive. At the moment, there is no incentive to book early; it’s entirely untested. But if you make it blatantly obvious that people who book early will pay much less, that can only be attractive. Commit now and it’s 20p. Come back in a week’s time and it’s a pound. Turn up on the evening of the show and it will be five pounds.

    And runs into the MPAA (or their UK lapdogs):

    I’ve promised them that I will remove the risk to their revenue by paying them a lump sum, somewhere between a few hundred and a few thousand pounds, to screen their releases; that way they get paid even if I turn out to be incompetent. But they’re not budging; they believe that when their $200m blockbuster can be seen for 20p, it cheapens the product.

    … it may transpire that what they are doing is illegal. They can’t tell me how much to charge the customers.

    This kind of pricing scheme can be taken a long way. How far depends on how people can adapt to it, not on the technology underpinning it.

    [/economics] posted at 15:01 #

    New wifi cards work on any frequency = no Linux drivers

    This gives us a preview of the major shitstorm that software radio is going to cause.

    [/technology] posted at 15:00 #

    South Korea: a futurologist’s wet dream

    Want to see what 70% broadband adoption does to a society?

    Korea tells you:

    But only gives you a taste of your future.

    [/technology] posted at 12:50 #

    Microsoft licenses Unix IP from SCO

    Coincidentally at the same time as SCO are suing IBM to stop Linux. Microsoft are a company capable of learning and adapting. What they learnt from the antitrust trial seems to be ‘get someone else to do your dirty work’.

    Late Sunday, Microsoft general counsel Brad Smith said acquiring the license from SCO “is representative of Microsoft’s ongoing commitment to respecting intellectual property and the IT community’s healthy exchange of IP through licensing”.

    Is he trying to imply something?

    [/technology] posted at 11:22 #

    Sun, 18 May 2003

    You can take my money but you can’t take my grades

    Sometimes D-Squared is good:

    If there was a revolution tomorrow then my binman would presumably still be in his old job, but Warren Buffet would be looking at a seriously reduced standard of living. So Warren Buffet ought to pay more than my binman for the cause of keeping the proles contented.

    And sometimes he’s awesome:

    I suspect that the class would agree to some sort of progressivity in the redistribution schedule, but not as much as they might suggest for the marginal rate of income tax. The difference between the answers would be a useful quantitative measure of exactly how hypocritical left-wing students are, a question that I suspect a lot of us would be mildly interested in.

    [/economics] posted at 11:16 #

    LifeLog, from the people who brought you ARPANET

    One good thing about having a (AWOL) fighter pilot in the White House - DARPA has a ton of money again.

    This project appears to be an attempt to create the kind of intelligence computers will need to be able to make sense of all the data of an individual’s life. The ultimate PA and PH (personal historian).

    [/technology] posted at 10:52 #

    RFID tag + mobile phone = credit card
    That IBM ad where the guy in the trenchcoat looks like he’s shoplifting but is actually paying wirelessly (hoho!) is now more than an ad.

    [/technology] posted at 09:46 #

    Intranet weblogging at Google

    Interesting. How long until “x years blogging experience” appears on job adverts?

    [/misc] posted at 08:58 #

    Sat, 17 May 2003

    WiFi phones in use

    Fortune article titled “This Is Not a Cellphone”.

    At 27 of Group Dekko’s 30 locations around the country, managers and supervisors use special handsets to make and receive voice calls on the same wireless broadband network the company uses for Internet access. The calls are converted to Internet Protocol data “packets.” They essentially travel for free as long as they stay on Group Dekko’s wireless intranet.

    So why not marry the two technologies (WiFi + GSM)? In fact, Motorola, Proxim, and Avaya are jointly developing handsets and gear that will let callers roam between the two types of wireless networks. By the end of the year the companies will begin testing phones that run voice over Wi-Fi in the office and voice over cellular on the go.

    This is what’s going to kill 3G and strip most of the profit out of being a mobile GSM network provider.

    [/technology] posted at 10:48 #

    Thu, 15 May 2003

    Cuba was part of the developed world in 1957

    Brad DeLong offers excellent counterpoints to those who have (economically - at least) tried to give Castro some credit.

    The hideously depressing thing is that Cuba under Battista—Cuba in 1957—was a developed country. Cuba in 1957 had lower infant mortality than France, Belgium, West Germany, Israel, Japan, Austria, Italy, Spain, and Portugal. Cuba in 1957 had doctors and nurses: as many doctors and nurses per capita as the Netherlands, and more than Britain or Finland. Cuba in 1957 had as many vehicles per capita as Uruguay, Italy, or Portugal. Cuba in 1957 had 45 TVs per 1000 people—fifth highest in the world. Cuba today has fewer telephones per capita than it had TVs in 1957.

    You take a look at the standard Human Development Indicator variables—GDP per capita, infant mortality, education—and you try to throw together an HDI for Cuba in the late 1950s, and you come out in the range of Japan, Ireland, Italy, Spain, Israel. Today? Today the UN puts Cuba’s HDI in the range of Lithuania, Trinidad, and Mexico. (And Carmelo Mesa-Lago thinks the UN’s calculations are seriously flawed: that Cuba’s right HDI peers today are places like China, Tunisia, Iran, and South Africa.)

    [/economics] posted at 10:55 #

    Apple’s backdoor napster clone

    The theory is that Apple intentionally made iTunes transparent enough that semi-legal file sharing systems could be built around it. Hopefully sidestepping legal problems.

    Apple could be the first company to understand how open, commercial and underground code can be combined to benefit their customers and their own bottom line.

    The next test comes when the Apple have to decide how to deal with iTunes clones and unofficial iTunes Music Store clients. If they wield the DMCA they will lose the faith of many.

    [/technology] posted at 10:02 #

    Wed, 14 May 2003

    Romero developing for the N-Gage

    Slashdot brings news from E3 that Doom and Quake co-creator John Romero is developing for Nokia’s new gaming oriented phone.

    In the long term the mobile phone will destroy the Gameboy, and with Sony looking to enter this market, Nintendo should be looking for a new revenue stream.

    [/technology] posted at 10:39 #

    IT goes golden or grey?

    Interesting Economist article about IT leaving it’s exponential roots behind and ‘just working’. I read somewhere that this is actually regurgitated Oracle PR but I’m a sucker for slick historic parallels, so:

    When Britain’s railway mania collapsed in 1847, railroad shares plunged by 85%, and hundreds of businesses went belly-up. But train traffic in Britain levelled off only briefly, and in the following two decades grew by 400%.

    Brad DeLong, an economics professor at the University of California at Berkeley, puts it somewhat more succinctly: “I am optimistic about technology, but not about profits.”

    [/technology] posted at 07:26 #

    Tue, 13 May 2003

    Amazon.com actually very healthy

    Damn, while I was waiting for them to die, Bezos was doing a really good job sorting them out.

    [/economics] posted at 09:33 #

    Mon, 12 May 2003

    Sub-City Tunnelling

    Here’s something from last month’s Wired that I missed. The emergence of tunnelling technologies that appear to make underground suburbs (underburbs?) economically inevitable.

    You won’t hear much talk of it outside of specialized engineering circles, but we’re at a tipping point. The cost to burrow down is dropping, while the price (and hassle) of erecting a skyscraper in a dense urban area just keeps rising. The breakthrough comes thanks to tunneling technologies that are now being used on huge transportation projects, like Boston’s Big Dig and Moscow’s Lefortovo highway tunnel project. Over the next 10 years these techniques will be used to hollow out space beneath the world’s great cities.

    [/technology] posted at 17:46 #

    Stanford’s 1k page/hr book scanning robot

    Fantastic milestone on the way to universal digitisation of the world’s knowledge.

    For Mr. Keller the most vexing challenges are neither labor costs nor technology. Librarians, he said, must find a way to address the copyright restrictions that appear to be tightening as a result of new federal laws like the Digital Millennium Copyright Act of 1998.

    And people wonder why there are so many libertarians on the Internet.

    Another project, led by the Internet Archive in San Francisco, recently shipped 80 tons of old books acquired from the Kansas City Library to Hyderabad, India, where they will be scanned, according to Michael Lesk, a former National Science Foundation official and digital library expert who works with the archive.

    Excellent.

    [/technology] posted at 14:00 #

    Fri, 09 May 2003

    Closet fark photoshopper interviewed

    Former Los Angeles Times photographer Brian Walski is interviewed about his fake Iraq war photo.

    And the Internet thing, that’s hard to deal with. I did a Google search on my name, and it comes up in about 25 languages. Every photographer wants to be known for a picture he’s taken. I’ll be known for this.

    Chalk up another old media worker’s education as complete.

    [/media] posted at 16:57 #

    Thu, 08 May 2003

    Source to commercial album available

    I dislike old man rock as much as anyone my age, but Marillion are showing us a fleeting glimse of a more open music production method.

    [/misc] posted at 12:05 #

    Wed, 07 May 2003

    Decentralised security camera watching

    Another sighting of the transparent society on the horizon.

    [/technology] posted at 11:05 #

    Social skills first developed to enable large game hunting

    Meat eating as the basis of civilisation. Vegetarians declared 'Untrustworthy'.

    [/society] posted at 08:55 #

    What happens when the future starts to evenly distribute

    Pre-natal scans look set to - in the long-term - indirectly solve India’s overpopulation and women’s rights problems.

    [/society] posted at 08:43 #

    Tue, 06 May 2003

    BBC continues to defy logic by being good

    BBC shows interest in becoming enabler in addition to broadcaster.

    [/media] posted at 13:38 #

    Stalinesque photoshopping in Evening Standard

    Sometimes, the anachronisms come from the wrong direction.

    The source of the image is footage from the BBC. The Standard’s paperboys were obviously allowed to clone and blur the image in numerous ways to make it look like a gigantic crowd.

    [/media] posted at 11:43 #

    Thu, 01 May 2003

    SARS 1.0 Released

    Today’s head fuck: being able to download the sequenced SARS genome.

    ATATTAGGTTTTTACCTACCCAGGAAAAGCCAACCAACCTCGATCTCTTG
    TAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTAGCTGTCGCTCGGC
    TGCATGCCTAGTGCACCTACGCAGTATAAACAATAATAAATTTTACTGTC
    GTTGACAAGAAACGAGTAACTCGTCCCTCTTCTGCAGACTGCTTACGGTT

    [/technology] posted at 20:36 #

    Iranians blog for freedom

    Looks like Iran could be the first country to geek it to freedom.

    … the underlying Catch-22 here. Bloggers are under the radar of the hard-liners, and that gives them unprecedented freedom. Losing a prominent voice like Motallebi’s is a blow to the community, but losing Net access would be an even more devastating blow. So while bloggers are asking for his release, they hope for the attention of human rights groups, the mainstream press and objective voices — not the saber-rattling of some ideologues.

    Jarvis for one, envisions a future without fear. “Eventually, all but the most Stone Age governments will have to let the Internet in because it has become the price of doing business in the world, and with it comes access to information and the ability to publish to the world (at no cost, with no expertise). The tools of publishing and broadcasting are coming into the hands of the people, and that will make a difference in the world.”

    Preach it!

    [/media] posted at 18:11 #