Stu's Weblog
   


Stu's Weblog, Stuart Robinson's blog on technology, economics, society and media. Technology, economics, society and media.

Stuart Robinson
Mail: stublog at copywrong.org

RSS v0.9x Feed


Calendar
←July→
Sun Mon Tue Wed Thu Fri Sat
   
15
   

2003
Jul


Blogroll

  • Brad DeLong
  • Danny O’Brien
  • BoingBoing
  • Ben Hammersley
  • John Robb
  • MPT
  • Adam Curry
  • Doc_Searls
  • Phil Windley
  • Joel
  • Lessig
  • jwz
  • Aaron_Swartz
  • Where is Raed ?
  • D-Squared

  •        
    Tue, 15 Jul 2003

    Jon Stewart on media bias

    I want to watch the Daily Show from after reading Jon Stewart commenting on the US news networks.

    But the other [than Fox] news networks— you know they have this idea that they’re being objective. But news has never been objective. It’s always— what does every newscast start with? Our top stories tonight. That’s a list. That’s an object— that’s a subjective— some editor made a decision; here’s our top stories.

    #1. There’s a fire in the Bronx.

    #2. They arrested Martha Stewart.

    Whatever— however you place those stories, is a subjective ranking as much as AFI’s 100 Best Films in the World is.

    Google News offers the framework for a more democratic way to prioritise stories. Franchise is restricted, however, to Big Publications. Technorati - and others - offer similar services but extend the vote to all (blog) publishers. Unfortunately they currently only group by link, not by story.

    [/media] posted at 22:48 #

    Mon, 14 Jul 2003

    GPS keeps on coming

    Fast Company on the huge efficiency gains GPS is going to bring.

    Struggling to imagine possible uses?

    Qualcomm, which supplies satellite tracking and messaging services to 300,000 trucks across North America, is testing GPS truck-trailer locks that would allow cargo to be unloaded only at the correct location. Qualcomm routinely fields inquiries from people wanting to use GPS in new ways. A plasma-screen TV manufacturer wanted to install GPS tracking in each screen as an antitheft measure. A cattle rancher wanted GPS collars for his cows. Two school districts in Pennsylvania with GPS-equipped buses offer families an alert when the school bus is approaching, a system dubbed “Here Comes the Bus.”

    Even farming won’t escape this revolution (although subsidies will slow adoption):

    The Glenns got another surprise. Matching the fertilizer map with the next year’s harvest map, they saw that weak areas of fields aren’t helped much by fertilizer. But strong areas produce even more strongly with extra fertilizer. “We’ve cut our nitrogen use by 10% to 12% in the last few years, with the same yields or better,” Don says.

    “And that’s environmentally friendly,” says Brian.

    “And we’ve saved $5,000 or $6,000 in nitrogen costs, just on corn,” Don says. With their iPAQs, the Glenns use GPS the same way that the concrete companies do. Data gathered during the day — automatically, instead of scribbled in notebooks — is loaded into computers at sundown. Don now keeps track of how much every seed and drop of pesticide costs for every field, as well as how much the harvest brings — and he can easily call up a P&L statement on his laptop for every field.

    The present may be looked back on as the time of the blind organisation.

    [/technology] posted at 10:19 #

    Sun, 13 Jul 2003

    EU Myths

    I went to the Euromyths site to see if they could pull a modern day Publius on me. They did not. There are, however, some useful examples of just how manipulative the British tabloid press are.

    Myth number 1 - banning toy and sweet advertising Swedish style - was a disappointment. It still seems like a good idea.

    [/media] posted at 17:24 #

    AOL Journals - some history

    Washington Post piece on AOL’s plans to bring blogging to their masses.

    AOL will give members three ways to update their blogs — through an online template with blank boxes for text input, through AOL’s instant-messaging system or by telephone. The phone option will be available only to subscribers to the extra-cost “AOL by Phone” service, who will be able to leave voice messages that will be posted as MP3 sound files.

    The blogosphere is self-filtering and so should only be strengthened by more participants, but many probably expected Usenet to handle a similar influx without problems 10 years ago. It did not.

    [/technology] posted at 17:05 #

    Fri, 11 Jul 2003

    Dashboard - GNOME’s desktop agent

    Ximian’s Nat Friedman is hacking up something extremely cool, Dashboard.

    Here’s a sample scenario:

    1. In an IM conversation with someone, they ask you about some project you’ve been working on.
    2. The dashboard notices what you’re talking about and matches your latest design document for the project.
    3. You say to your friend: “Check out my current design.” and drag and drop the document from the dashboard onto your IM window.
    4. Gaim transfers the file to the other person.

    Many of the required components for the above to happen are ready. Nat is receiving a lot of support and progress seems very swift.

    Check out the screenshots of it integrating with (patched) versions of Evolution (email), Gaim (instant messaging), X-Chat (IRC) and Straw (RSS news reader).

    Nat brings up a good point about the feasibility of this kind of cross-app desktop communication.

    One important thing to realize is that it would never be possible to write something like the dashboard in a world where you can’t get the source code to your applications. This is the whole “basis for innovation” thing we’re always talking about.

    And some say there is no innovation in open source applications.

    Update:

    IRC log of Dashboard demo at OSCON.

    nat looks forward to doing some specialised backends for programmers

    That sounds very interesting. Context-sensitive help in any development environment.

    [/technology] posted at 17:15 #

    The quickest way to send 2.8 terrabytes of data

    Jim Gray, head of Microsoft’s Bay Area Research Center, calls his method TeraScale SneakerNet.

    DP Are you sending them a whole PC?

    JG Yes, an Athlon with a Gigabit Ethernet interface, a gigabyte of RAM, and seven 300-GB disks - all for about $3,000.

    DP How do you get to the 7-megabytes-per-second figure?

    JG UPS takes 24 hours, and 9 hours at each end to do the copy.

    [/technology] posted at 16:28 #

    Thu, 10 Jul 2003

    Briefly

    CTS - Combat Zones That See. High likelyhood that Baghdad will be a testing ground for some serious Big-Brother-tech.

    The physical reality of what censorship entails is impossible to ignore when it is reported like this.

    Skull vibrating headphones.

    From the new Wired:

    • DeLong has decided that we’re going to avoid deflation, so not to worry. I believe him - ‘peace of mind’ is all the justification I need for doing so.
    • Brute forcing invisibility.

    Grad student inadvertantly creates a treasure map for terrorists. Film title “The Dissertation” is available.

    [/misc] posted at 23:58 #

    Wed, 09 Jul 2003

    No RFID for Wal-Mart, for now

    Wal-Mart cancel RFID trial. By dramatically reducing demand and thereby keeping per-unit cost high, this could significantly slow the adoption of RFID. No need to microwave your new clothes for a little while longer.

    Wal-Mart Stores has unexpectedly canceled testing for an experimental wireless inventory control system, ending one of the first and most closely watched efforts to bring controversial radio frequency identification technology to store shelves in the United States.

    [/technology] posted at 23:48 #

    Estonia high tech

    After reading this Estonia has jumped up high on my ‘good places to hibernate in “low-cash” mode’ list.

    Estonians do 80 percent of their banking on the Internet, while businessmen habitually negotiate and close deals by firing text messages to each other’s cellphones. Farmers are ordering broadband lines, and motorists on rural roads frequently pass blue information signs pointing them to the nearest place to access the Web.

    Inside Tallinn’s medieval parliament and prime minister’s offices, cabinet ministers and legislators have gone completely virtual, conducting meetings, votes, and document reviews on their networked flat-screen computers.

    “We’re the first paperless government,” says former Prime Minister Mart Laar, from the entrance to the courtyard of his old office.

    In 2000, the parliament, perhaps inspired by their new gizmos, passed a law declaring Internet access a fundamental human right of its citizenry.

    [/technology] posted at 23:48 #

    Mon, 07 Jul 2003

    More Google Weblogs

    Good piece from the NYTimes containing some example uses of internal blogging. Of particular interest this about is Google:

    Google, the provider of Internet search services, has become a big user of blogs for communication among its employees and managers - a result of the company’s acquisition of Pyra Labs, the creator of the Blogger Web log service, earlier this year. On one internal blog, called Google Love Notes, the customer service staff posts thank-you notes from users. One is from a woman who nursed her sick dog back to health after researching the illness on Google; the posting includes a photograph of the healed dog frolicking in a stream. Another came from a woman who was able to find a long-lost love through Google - and who happily reports that she wound up agreeing to marry the man’s brother.

    “It’s a good pick-me-up,” Jason Shellen, a Blogger manager at Google, said of Love Notes.

    [/technology] posted at 22:29 #

    Phones with software defined radio due Q4 2004

    CNET have a piece on Chip designers Sandbridge, who appear to be close to releasing software defined radio chips.

    The White Plains, N.Y.-based company will begin shipping the chips this year to handset makers, and the first “world phones” will appear by the end of 2004, according to Sandbridge spokesman Jeffrey Schwartz.

    “That’s three to five years ahead of what people thought,” he said.

    No joking.

    via gizmodo

    [/technology] posted at 13:21 #

    Sun, 06 Jul 2003

    Catching up

    Solar powered parking ticket machine.

    Picture phones are being used as an always available camera, not for picture messaging. This ties up exactly with my personal experience.

    Fetchart, more cool iTunes only software. The amazon.com searching and scraping backend must be fairly trivial to port though.

    A dictionary of Nadsat - the dialect from Clockwork Orange.

    Novel visualisation of the tax burden. This is immensely more persuasive than talking about percentages.

    [/misc] posted at 13:33 #

    Opsound delivers

    Glenn Otis Brown points to the first example of a “collaboration across space and time … with no rights-clearing needed”. Possible because the original was Attribution-ShareAlike licensed.

    This happened on Opsound, which last time I checked was mostly ambience. It’s good to see it developing.

    [/misc] posted at 13:29 #

    The Baroque Cycle

    The new Neal Stephenson isn’t due until autumn but sounds good:

    Daniel, Jack, and Eliza will traverse a landscape populated by mad alchemists, Barbary pirates, and bawdy courtiers, as well as historical figures including Samuel Pepys, Ben Franklin, and other great minds of the age. Traveling from the infant American colonies to the Tower of London to the glittering courts of Louis XIV, and all manner of places in between

    Feel the research:

    On Sir Isaac Newton’s temperature scale, where freezing is zero and the heat of the human body is twelve, it is probably four or five. If Herr Fahrenheit were here with one of his new quicksilver-filled, sealed-tube thermometers, he would probably observe something in the fifties.

    [/misc] posted at 13:07 #

    Microsoft Apps on Linux

    One of the most interesting spread bets around is still open.

    USA TODAY: Is there a scenario by which you would at some point consider porting Microsoft applications into Linux?

    BG (Bill Gates): There’s no consideration of that at this point.

    [/technology] posted at 00:33 #

    Watching them watching us

    OK, I‘m back now. Lots to catch up on. That was very annoying.

    As predicted, here’s some citizen based pushback against the governmental monopoly on collaborative information gathering. GIA (Government Information Awareness).

    The premise of GIA is that individual citizens have the right to know details about government, while government has the power to know details about citizens. Our goal is develop a technology which empowers citizens to form a sort of intelligence agency; gathering, sorting, and acting on information they gather about the government.

    This image is from their sidebar and sums it up well:

    They’ve thought this through to the point of having anonymous identities - required for anonymous sources to become trustable.

    The system will accommodate information of almost any type, allowing users to sort through volumes of information which would otherwise be unusable. More importantly, the system allows for people to submit any information, while retaining anonymity, but while also being identified as a consistent source.

    The Boston Globe have a good write-up.

    As hosting these databases becomes standardised and affordable, forking will become possible. The possibility of a fork will provide similar benefits to the ones it brings to the development of Open Source. Focused but consensual management.

    One benefit our - now excessively retrictive - copyright regime may bring us is the early realisation of the importance of publically owned and licensed data.

    [/society] posted at 00:26 #

    Fri, 04 Jul 2003

    Political Campaigning in Mid 2003

    Lessig suggests that “building a community around your candidacy” is going to be the future of electioneering.

    American’s for Dean, are appealing for the Internet vote with astonishing persuasiveness:

    Warm up your news aggregator’s coz here the feeds of the future: “A pugnaciously populist insurgent candidate defeats a tax-cut-empowered $200+-million-campaign-budget-wielding popular war time president with a social-nodal-RSS-conjoined-web-network run on open-source-software-fueled by smart-mobbing-net-campaign-adhocracies straight out of a Cory Doctorow Creative Commons tagged short story.”

    Nocturnal can-do hacking ethos and gumshoe populist politics are the perfect patriotic fit. Special interest money committee formed candidates are itching for an expunging.

    While Arnold Schwarzenegger has a slightly more traditional strategy:

    “T3 is best seen as a $175 million campaign ad for Schwarzenegger’s bid to be California’s next Governor. Tough, buff Arnold helps kids, keeps bad machines from despoiling the environment and saves the state, all without spending the taxpayers’ money,” wrote Time Magazine movie critic Richard Corliss.

    [/politics] posted at 13:47 #

    Sun, 29 Jun 2003

    EU farming subsidy reform

    Good to see at least some progress made on abolishing the Common Agricultural Policy subsidies, AKA “let’s destroy the developing world’s ability to feed itself”.

    Under this reform the size of the subsidy stays the same (£31 billion a year) but the size of each payment is now decoupled from quantity produced. This should check excess production and the environmental and social damage it caused.

    A better explanation can be found here.

    [/economics] posted at 23:19 #

    Fri, 27 Jun 2003

    Briefly

    • NAT is slowing progress (particularly in VoIP I presume): “Bob Frankston, who worked at Microsoft to develop home networking the mid-90s, told me in late 2002 that he calls himself the father of NAT and said that NAT was one of the biggest mistakes he made. He shoulda gone with IPv6, he said.”

    [/misc] posted at 10:33 #

    Getting used to their teachers having lives

    Want to see what the society’s slide to transparency looks like on the ground?

    Here’s one case:

    This diary clearly made the students uncomfortable. There was, for one thing, a perception that she was writing about them (though I didn’t see it), but also a general discomfort with the idea of a teacher frankly discussing her sex life (which I also missed, apparently… I’m not sure the students and I visited the same link, now that you mention it). Or is it just the familiar student awkwardness at accepting teachers as human beings? How did that feel at 18? It’s hard for me to get a sense of that, because my parents were (are) teachers most of my life, and I’ve always thought of teachers as having lives outside the classroom.

    [/society] posted at 10:02 #

    Liberia

    The craziness in Liberia is easy to view as little more than another African civil war, but Liberia has a fascinating history and unique culture.

    First settled at the organisation of the American Colonial Society in 1822. Initially an American colony with the expressed purpose of repatriating freed slaves. Became an independent republic in 1847. Has been in economic straits since.

    In Africa, only it and Ethiopia were never colonised.

    [/misc] posted at 09:56 #


    Sometimes (sur)real life:

    imitates jingoistic comedy action figures:

    At least we now have some idea of where Saddam is hiding.

    [/misc] posted at 09:21 #

    Thu, 26 Jun 2003

    Blair as Mussolini

    There’s still time for a 16 year old somewhere to memorise this and write it as their history exam essay.

    They’d have to get an A, for the punch line alone.

    [/politics] posted at 20:34 #

    802.11i

    802.11i is the spec designed to beef up security for Wi-Fi.

    Why is this interesting? Because according to Wi-Fi Networking News:

    The last piece to deal with is to “agree on solution for secure fast roaming to support voice applications.”

    So that’s encrypted roaming VoIP over Wi-Fi, due May 2004. The drum beat gets louder.

    [/technology] posted at 15:49 #

    Open Source in the developing world

    It’s a pleasant surprise to see MSNBC (via Newsweek) laying into one of their proprietors so harshly, but it needs to be said.

    After the South African government threw its support behind the open-source movement last year, Microsoft offered to supply free software to government-run schools in South Africa. Hilton Theunissen, the project manager at Nooitgedacht Primary School, is skeptical of Microsoft’s sudden altruism. “For years and years I was writing letters to Microsoft, always asking for software donations,” he says. “What I ended up receiving was either a negative reply or no reply at all.”

    Microsoft is behaving like a crack dealer.

    [/technology] posted at 14:09 #

    Wed, 25 Jun 2003

    Another Westminster blog

    Richard Allan is the second UK MP to have a weblog (that I’m aware of).

    I just bumped into Tom Watson MP in the corridors of the House of Commons and we greeted each other for the first time in the real world! Funny business this that we have exchanged comments through our blogs but never spoken to each other before.

    [/technology] posted at 21:20 #


    On what would have been Orwell’s 100th birthday - William Gibson writes about the coming transparent society:

    As individuals steadily lose degrees of privacy, so, too, do corporations and states. Loss of traditional privacies may seem in the short term to be driven by issues of national security, but this may prove in time to have been intrinsic to the nature of ubiquitous information.

    The constant elusiveness of truth:

    A world of informational transparency will necessarily be one of deliriously multiple viewpoints, shot through with misinformation, disinformation, conspiracy theories and a quotidian degree of madness. We may be able to see what’s going on more quickly, but that doesn’t mean we’ll agree about it any more readily.

    How Orwell’s medicine was preventative:

    Orwell did the job he set out to do, did it forcefully and brilliantly, in the painstaking creation of our best-known dystopia. I’ve seen it said that because he chose to go there, as rigorously and fearlessly as he did, we don’t have to.

    It might be a good idea to get another prescription soon.

    [/society] posted at 20:41 #

    The Next World Order?

    Bruce Sterling:

    The New World Order, proclaimed in Gulf War I, died in Gulf War II. The Next World Order has means, motive, and opportunity now. Instead of the customary 20th-century hot air and phony baloney, it might turn out to be rather hands-on, tough-minded, and practical. There are good reasons to think this will happen, with or without American cooperation. The Next World Order may well look like nothing we previously were led to expect.

    George Monbiot:

    The UN Security Council should be scrapped, and its powers vested in a reformulated UN General Assembly. This would be democratised by means of weighted voting: nations’ votes would increase according to both the size of their populations and their positions on a global democracy index. Perhaps most importantly, the people of the world would elect representatives to a global parliament, whose purpose would be to hold the other international bodies to account.

    I have also suggested some cruel and unusual means by which these proposals might be implemented. Poor nations, for example, now owe so much that they own, in effect, the world’s financial systems. The threat of a sudden collective default on their debts unless they get what they want would concentrate the minds of even the most obdurate global powers.

    That kind of threat is simultaneously fascinating and terrifying. International financial suicide bombers.

    [/society] posted at 16:18 #

    Mon, 23 Jun 2003


    Here’s preparation for the joys that even a compromised copyright reform will bring.

    Black popular music c1940’s to 1970’s … Music from both Jamaica and America

    At the moment there are 145 top sounds to play (mp3) for your musical pleasure, 7 per page, marked with S, and over 995 fascinating record labels to view, they are added to at about 10 a week.

    via a cryptic mefi post

    [/misc] posted at 21:32 #

    Tim O’Reilly thinks a lot

    Thanks to a (hopefully not too impressionist) “Impressionistic transcript” from Cory Doctorow, we can sample Tim O’Reilly’s incredible brain dump at Reboot:

    We’re in the middle of another paradigm shift:

    Linux critic: Linux isn’t user-friendly

    Linux geek: Linux will be better in the next rev

    They’re both wrong: the apps that run on Linux are Google,
    Amazon, etc. Not shrinkwrapped apps, but new platforms.

    Platforms made a lot more financially viable, precisely because they run on free software and commodity hardware.

    This ties up with Jason Pellerin’s point that LAMP is a saviour much more than Mozilla.

    Shirky’s “Listening to Napster:” You can build a big database by:

    1. Paying people (Yahoo)

    2. Getting volunteers (DMOZ)

    3. Architect the system so that users’ natural activity yeilds a
    database (Napster)

    That’s the secret of what’s happening on the Internet today.
    Every time you make a link, you contribute to Google. Amazon
    reviewers improve Amazon. This outstrips OSS projects for
    collaboration.

    There’s so much innovation still coming up in the use of networks. Today, no-one really understands how to use a networked computer.

    What keeps me up at night?
    • No one in OSS seems to care about Google/Amazon/eBay (I told
      Bezos off for pissing in the well when he sued BN.com)
    • Users don’t own their data — who cares about source when your
      data is locked in?

    O’Reilly implies a solution for the first: Don’t abuse the excess IP protection offered by bribed legislatures, stick to open innovation. He addresses the second in more depth here.

    I’d also suggest state mandated exportability of personal data from all applications, web or desktop… but I hear people don’t like that sort of thing. The market will get there alone, but being nudged toward the eventual - more open - compromise would help everyone.

    [/technology] posted at 16:01 #

    John Kay

    Financial Times columnist John Kay has some great articles on his site including, but by no means limited to…

    Bayesian probability and the law:

    Thomas Bayes, an 18th-century Nonconformist clergyman, discovered that his game of billiards was improved by an understanding of contingent probabilities - the likelihood that an event will occur if some other event has already occurred.

    The demise of economics:

    Back in the 1960s, when I decided to take up the subject, economists were living in a golden age. The world economy had experienced two decades of unprecedented growth and stability. It seemed that Keynesian policies could cure unemployment and control the business cycle.

    [/economics] posted at 15:51 #

    Sun, 22 Jun 2003

    Illegal Art

    Illegal Art. Suggests the possibility of eventual widespread everyman support for copyright reform.

    Mickey mouse gasmask:

    via Tim O’Reilly

    [/society] posted at 18:09 #

    The Phone Co-op

    One of my Grandfathers believed in the The Co-operative Group and worked for them for many years. He also worked for British Telecom. When they were privatised he refused on principle to take any of the shares options he was entitled to.

    He would have been pleased to see The Phone Co-op.

    Marketing appears to only work on a profit motivated basis though.

    [/economics] posted at 12:09 #

    An imagined parallel, I hope

    San Francisco today:

    The latest episode to anger legislators was a decision by the Foundation for Taxpayer and Consumer Rights to post on the Internet partial Social Security numbers of lawmakers who did not support the latest attempt to increase protections on personal financial information.

    vs.

    The now imprisoned Jim Bell in 1997:

    Assassination Politics I speculated on the question of whether an organization could be set up to legally announce that it would be awarding a cash prize to somebody who correctly “predicted” the death of one of a list of violators of rights, usually either government employees, officeholders, or appointees. It could ask for anonymous contributions from the public, and individuals would be able send those contributions using digital cash.

    [/politics] posted at 11:14 #

    Sat, 21 Jun 2003

    Zero Knowledge

    Ever wondered what happened to Zero Knowledge, the 1997 Canadian start-up with a board of advisors featuring Lawrence Lessig and Bruce “Blowfish” Schneier? They lured Mozilla’s Mike Shaver away at the peak of the boom to build ”’Freedom’ technology … provides pseudonyms, encryption, and an anonymizing network to protect privacy online”.

    Well, they survived the crash, but only by selling antivirus/firewall/popup-block boredom to customers and privacy policy management packages to business.

    Now the happier part, ‘Freedom’ now does provide the encrypted anonymous web surfing service expected, after dropping cross OS support and being renamed to ‘Freedom WebSecure’. $60/month. Check out the ‘rave reviews’.

    [/technology] posted at 22:30 #

    Loving is not funding

    I took this photo here in east Oxford last week. It is a UK government advert “Targeting benefit fraud”. Someone has pasted “Love thy neighbour?” over the top.

    Pure insanity.

    [/society] posted at 16:38 #

    Undesigned

    Those of you reading this in an aggregator can completely ignore this.

    Those in a browser will have noticed that things are looking a little plainer round here. What started out as an intended transition to CSS, turned into a full blown redesign.

    The trickyness of pixel-perfect cross-browser CSS designs push non-designers like me towards simplicity. This is probably a good thing.

    [/meta] posted at 16:14 #

    Fri, 20 Jun 2003

    Blogging not on the radar for most CIOs

    John Patrick (former IBM chief dreamer) reports that the CIOs he’s met “… think they need blogging like they need a hole in the head”.

    During the past week, I had the pleasure of meeting with quite a few senior executives — mostly CIO’s — of major corporations. They were all familiar to varying degrees with WiFi but not one had even heard of blogging. One said, “blobbing?”.

    Once I explain what blogging is all about, the typical response from people is that they are already in “information overload” to how could they possibly take on reading or writing a blog?

    via Due Diligence

    [/technology] posted at 22:47 #

    US current account deficit

    This piece about the current account deficit has been all over the blogosphere recently. It’s position reminded me of one of the things this guy/crank has been saying for years.

    The idea that imperialism has a tendency to financially overstretch is comforting, and has historic precedence, but I don’t have the economic understanding to know whether it is correct as presented.

    The Economist has this which gives a slightly more credible correction scenario.

    [/economics] posted at 09:49 #

    A TiVo for daily life

    Here’s something I will be loving once it is a more mature (and discrete!) technology. The equivalent of a TiVo for your daily life. Glimpses and glances will become solid referenced memories.

    Mini-camera mounted on glasses

    Once you get enough capacity to store the whole day and some kind of AI that can intelligently process the data, things start to get very interesting.

    If that sounds far fetched, bear in mind that it’s a subset of DARPA’s LifeLog. The whole project also includes recording audio and positioning data.

    [/technology] posted at 09:22 #

    Monthly update

    Well, it’s been a month since I started doing this in real-time. It’s been fun and educational, and I still find writing well incredibly difficult.

    I regret that soon after I started blogging, I lost the time I needed to study a wide of variety of subjects. Work on my dissertation is engaging and the framework already functions as a basic RSS aggregator. But I don’t want to post about BEGIN block behaviour under mod_perl or RSS 1.0 using the obscure “W3CDTF” date format - and that is what I have to spend my time thinking about at the moment.

    Maybe this is a useful feedback mechanism. If I don’t want to write about it, how interested do I really find it?

    Basically, that is my excuse for topic drift. Normal service can now resume…

    [/meta] posted at 09:18 #

    Wed, 18 Jun 2003

    Quick Links

    The Washington Post tries to introduce some objectivity into Jessica Lynch debate. Good luck.

    These guys are reverse engineering the iTunes protocols and creating open components for a global jukebox as they do so.

    Joel brings news of Salam Pax’s photoblog.

    [/misc] posted at 11:52 #

    Pizza for homeless billboards

    The first person to introduce this in Oxford would make a killing. There seem to be more panhandlers (per-person) here than anywhere I’ve been to. A result of the easy student pickings, no doubt.

    Instead of going Dumpster-diving for maybe a half-eaten sandwich and some cold fries, Peter Schoeff, a 20-year-old homeless man, was served a slice of hot pizza dripping with cheese.

    All he had to do was hold a sign for about 40 minutes that read: “Pizza Schmizza paid me to hold this sign instead of asking for money.”

    Minimum wage what?

    [/society] posted at 11:41 #

    Gates backs Mesh WiFi

    Here’s a surprise. Bill Gates has come out saying he expects mesh WiFi to provide universal broadband access and replace cell networks for many.

    I need to recalibrate my pie-in-the-sky-ometer.

    [/technology] posted at 11:31 #

    Kickstarting WiFi demand

    Glenn Fleishman has a viable theory as to what will kick-start WiFi demand.

    … the catalyst for widescale uptake in hot spot network subscriptions is that 25 of the top 35 airports in the US will offer substantial Wi-Fi service throughout their terminals. The minute a business traveler truly understands that in the majority of their travels, for a flat rate of $30 to $50 per month (depending on operator), they can have unlimited access, then the wall falls down, and the customer base surges.

    [/technology] posted at 11:31 #

    Iraqi Suffering

    Never let anyone tell you freedom isn’t expensive. Iraqis are just starting to find out with their first boy band. This is the most incredible quote:

    “We lived under dictatorship for 35 years. I’m not prepared to go through that again, and I don’t think anybody is,” said lead singer Nadeem Hamed, a 20-year-old biology student. “If people attack us for being in a band, that’s terrorism.”

    It seems even non-native speakers of english have absorbed the redefinition of terrorism.

    Let’s hope they can just compromise on a law forbidding the sale of music to under 16’s.

    [/society] posted at 11:30 #

    Mon, 16 Jun 2003

    In Brief

    Glass That Glows and Gives Stock Information.

    Karoshi - death from over work - recorded cases have more doubled between 2001 and 2002. Via Phil Wolff.

    Social engineering still the way to go

    Lawrence Lessig and Matt Oppenheim (the RIAA’s senior VP of business and legal affairs) touch gloves but throw few punches.

    Importance of permalinks as enabler of global overlapping conversations becoming clearer.

    Finally, a couple of earth as a computer metaphors:

    [/misc] posted at 09:09 #

    A history of Political Spectrum

    Over at kuro5hin there is a article covering the history of political spectrums which introduces (to me) the Vosem chart. It is 3-dimensional, the new dimension being pro/anti corporate.

    The Nolan was introduced to help the Libertarian debate, and I guess this is being introducted to try to assist in anti-corporate debate.

    The ASCII art diagrams are worth checking out.

         Revolutionary     Revolutionary reactionary
            radical   xxxxxx  
                   xx        xx  Reactionary
         Radical  x            x
                 x              x  Standpat
                 x              x
        Liberal  x              x
                 x              x Conservative
                  x            x
                   xx        xx
                      xxxxxx
    
                     Centrist
    

    [/politics] posted at 08:58 #

    Sun, 15 Jun 2003

    Bhutan’s pursuit of cathode-ray happiness

    The Guardian has this piece on the social destruction apparently caused by the introduction of TV in Bhutan. I’m just going to quote the utilitarian tragedy:

    “His Majesty decided that, as a spiritual society, happiness was the most important thing for us - something that had never been discussed before as a policy goal or pronounced as the responsibility of the state.” And so, in 1998, the Dragon King defined his nation’s guiding principle as Gross National Happiness.

    But happiness proved to be an elusive concept. The Bhutanese wondered whether it increased with a bigger house or the number of revolutions of a prayer wheel. A delegation from the foreign ministry was sent abroad to investigate whether happiness could be measured. They finally found a Dutch professor who had made its study his life’s work and were disappointed to learn that his conclusion was that happiness equalled UKP 6,400 a year - the minimum on which one could live comfortably. It was a bald and irrelevant answer for the Bhutanese middle classes, whose average annual salary was barely UKP 1,000 and whose outlook was slightly more metaphysical.

    I can image the constitution: “Life, liberty and the state standardised level of happiness”.

    [/society] posted at 10:51 #

    Sat, 14 Jun 2003

    Browser developments

    Microsoft conceed the Mac browser market to Apple:

    “The feedback we’re getting from our customers and the features they’re asking for is all pointing to Apple and Safari,” said Sommer. “Apple has better resources because they have Safari and the operating system.”

    Sommer is Jessica Sommer, Product Manager for Microsoft’s Macintosh Business Unit.

    Meanwhile, Mozilla (Firebird) is now so good even former ‘softie Joel Spolsky has switched to it.

    There was a time when Microsoft looked set to use ISS and IE to remake the web in their proprietory image. That time is over. HTML and HTTP are staying open. Mozilla and Apache need more respect for that.

    The battle now starts over the next layer of abstraction.

    [/technology] posted at 10:19 #

    Gentle Moderation

    Proof that there’s plenty of innovation left to come even in areas of the web
    that seem mature. Sam Ruby has invented a gentle form of discussion moderation. Any flamebait in his comment section is struck through and linked to a page explaining why.

    At the moment, the best solution I have come up with is to mark up the portions I find objectionable with links to this page. No words are added, deleted, or rearranged in the process.

    Mark Pilgrim has also adopted the technique and provides a more eloquent description than I can.

    I will annotate comments, and portions of comments, that I feel are personal attacks against me or others. Such flames will be marked as deleted and linked to this page.

    This is an idea built on the assumptions of hyperlinking and text styling. I’m watching with interest.

    [/technology] posted at 08:41 #

    Fri, 13 Jun 2003

    The Homeless Guy

    After the thrill of finding Salam Pax blogging from Baghdad I completely forgot about The Homeless Guy blogging from a library in Tennessee.

    He looks set to get an apartment soon, but it’s still an interesting preview of the kinds of conversation that will emerge as technology distributes.

    [/society] posted at 11:09 #

    Stanton Warriors at Oxford (finally)

    My ears are still ringing from last night. Stanton Warriors (rescheduled from 2 weeks ago) at Ponana here in Oxford. It was awesome, as expected.

    A lot of criticism of dance music is focused at DJs as mere players of other peoples records. This misses the benefit of having a free market in music selection and compilation. Impartial and self-motivated, the DJ is a naturally emerging division of the labour required to produce a sequence of music to be danced to.

    The music selection methods for other genres are less dynamic and flawed. Almost all breaking classical music in the UK has been featured in a TV advert, therefore the selectors are advertising agencies. Popular pop/rock has to first be chosen by a record company and then stamped with the approval of Radio/TV.

    [/misc] posted at 11:08 #

    Having others do your RSS research for you

    Articles titled “How to consume RSS safely?” are useful when your dissertation project is all about RSS, but somehow this has been turned into ammunition for yet another RSS flame war.

    Weak analogy: conducting flame wars over multiple blogs (and their comments) is guerilla warfare. Trench warfare like flaming still exists on mailing-lists/discussion-boards. This is progress of sorts.

    [/technology] posted at 11:08 #

    Cell biology related to distributed computing

    Something ingenious I missed the first time via, uh, Sam Ruby.

    If you sort biological organisms by size, you will see a point at which the strategy shifts from making larger cells to making more cells. Cells are surrounded by a trust boundary. Cells communicate by two basic mechanisms.

    In the first mechanism, the sender determines the action to be taken. The request penetrates the membrane and then employs the machinery within the cell to execute per the instructions contained within the message.

    In the second mechanism, the receiver determines the action to be taken. The request matches a receptacle on the membrane and the cell uses this information to trigger biological processes.

    In biological terms, the agent of the first mechanism is called a virus, and the agent of the second mechanism is called a hormone. In larger organisms, there is a strong preference for the second mechanism.

    [/technology] posted at 11:07 #

    Thu, 12 Jun 2003

    Senator Jerry Springer?

    Jerry Springer has a website up for the purpose of “exploring a Senate run in 2004”. It looks like he is running on one of the most populist platforms ever.

    … let me sum up what we face in the following quote from a right wing journalist recently appearing on CNN with Wolf Blitzer:
    “Voter turnout is not a glorious thing. If Jerry Springer shows up, he’ll bring all these new people to the polls. They will be slack-jawed yokels, hicks, weirdos, pervs, and whatnot.”

    That’s what they think about ‘all these new people’ getting involved and threatening the hold of elites on this country. That’s what they think about most of us! That’s why we have this exploratory site.

    That’s not what they think about you Jerry. It’s what they think about the folks you’re targetting your campaign at.

    It’s the dishonesty that makes false populists like Springer annoy me more
    than the elitist politicos he is targetting.

    [/politics] posted at 11:04 #

    Matrix Reloaded Debrief

    Seen the Matrix Reloaded? Make sure you understood it (major spoilers if you haven’t):

    I’m still not sure I do.

    To fully appreciate the visuals read up on why they are truly revolutionary.

    [/misc] posted at 00:25 #

    An algorithm for soul-searching

    Sadly unimplementable.

    1. Classify personality traits into nature (evolved) or nurture (learned).
    2. For learned traits: identify the lessons and assess the general viability of the learned response.
    3. For evolved traits: identify benefits gained from trait and assess relevance to modern world.

    [/misc] posted at 00:25 #

    Tue, 10 Jun 2003

    Hair, rackets and turned cheeks

    Early humans lost hair to beat bugs :

    “In animals, ectoparasites like biting flies, exert tremendous fitness costs - they really affect our health,” he told New Scientist. “Our view is that hairlessness is an adaptation for reducing the ectoparasite load.”

    Protection rackets appearing in “The Sims” virtual world:

    “They show up at your house and they request protection money. `You have to pay me 100,000 simolians if you don’t want your house torn down.’ It’s technically harassment.”

    Someone is probably working on a sociology paper covering this already.

    Finally, although I don’t share it’s basis or conclusions I’m happy to see Christian anti-Bush backlash starting.

    [/misc] posted at 18:45 #

    Auto DJ software I can’t use

    Ask the DJ is an idea I’ve had before but assumed would be difficult to implement. It’s iTunes/MacOS-X only - hence the title - and so I still don’t know how difficult it would be to do well.

    Unlike any other software, Ask the DJ analyses beats to perform truly seamless transitions between tracks. Like a real DJ, it matches beats and adapts tempos whenever needed so the music always flows, even when cross-fading between tracks with different bpms.

    Linux needs a media framework as inviting to developers as iTunes seems to be. Researchless, XMMS or Gstreamer come to mind as possible contenders.

    [/technology] posted at 18:44 #

    Mon, 09 Jun 2003

    Mobile email creating ‘Computer Refuseniks’

    Phone text messaging in Japan is different to the SMS messaging offered in Europe and the US. Each user has an email address, and each message is effectively an email. One surprising (to me) outcome of that is it delays the age by which Japanese become computer proficient.

    Japan Media Review labels these people ‘Computer Refuseniks’

    “Five years ago, before cell phone e-mail came into such widespread use, all college students felt the need to own their own PCs,” says Hiroshi Hanamoto of the online marketing firm Promotions. “Today, students with cell phone mail can easily get by without buying their own computers. Besides, they don’t have the money.”

    [/society] posted at 21:36 #

    Britain and the Euro

    An economists view on the arguments for and against Britain joining the Euro. Brad Delong has interesting commentary and pointers.

    [/economics] posted at 21:35 #

    Visual babelfish

    Nice to see progress on the visual/text babelfish coming along nicely. When finished I want this overlaid in real-time on my glasses.

    Researchers in Hewlett-Packard’s labs have developed their own method of pairing a digital camera and computing device to translate signs and text in a foreign language back into English. The technology, a software applet running on an Hewlett-Packard iPaq PDA, will hopefully form the foundation for an eventual product, researchers said.

    via gizmodo

    [/technology] posted at 21:35 #

    Guardian adapting to the new rules of media

    The Guardian’s efforts to adapt to the emerging world of an audience poised to “fact check your ass” give hope. At least some of the old media press will maintain some credibility through the transition.

    On Wednesday, journalists on the Guardian’s website were alerted to a story running in the German press, in which the US deputy defence secretary, Paul Wolfowitz, was said to have admitted, in effect, that oil was the main reason for the war in Iraq. The German sources were found, translated, and at 4.30pm that day a story sourced to them was posted on the website under the heading, “Wolfowitz: Iraq war was about oil”.

    Mr Wolfowitz, in fact, had said nothing of the kind, as a deluge of email, most of it from the US, was quick to point out. Some of it registered disappointment more than anything else - disappointment that a valued source of news and liberal comment had in this instance let them down. “The briefest of searches will bring up articles to totally discredit your story,” one complained.

    [/media] posted at 10:17 #


    Bruce Sterling reveals his strangely binary view of the Transparent Society. I need to read his book.

    [/society] posted at 01:17 #

    Feudalism, capitalism and socialism

    Capitalism is alive and well, living inside a greatly transformed feudalism.

    What does socialism need capitalism for? Wealth.

    What does capitalism need feudalism for? Security.

    The chains of loyalty and honor and oath taking that was feudalism are still existant, the form has just evolved into the modern military, law enforcement, and nation-state government.

    — Mark Atwood

    [/society] posted at 01:15 #

    Bezos working on his whuffie

    Jeff Bezos is looking a bit cooler after he bigged up Cory Doctorow on NPR for his (Creative Commons licenced) book and particularly it’s reputation system - Whuffie. More interesting commentary on Whuffie can be over a AKMA’s Random Thoughts - in Raph Levian’s comment.

    In fact, there are systems which attempt to measure Whuffie. I did my PhD research on “trust metrics,” which are basically the same thing. Google’s PageRank is also a decent model of Whuffie in the web world.

    Saying “AKMA is a good person” is nice, but doesn’t help identify the source or credibility of that opinion. By contrast, “AKMA has lots of Whuffie” clearly identifies the opinion as coming from someone who is very up to date in the online world.

    Actually my real motivation for this post is that it gives an excuse to mention Cory’s collaborative work-in-progress with Charlie Stross. Unwirer is both:

    • an exploration of the value of wireless networking in a USA with a regulated internet
    • an insight into the craft of collaborative short story writing

    [/misc] posted at 01:15 #

    Sun, 08 Jun 2003

    G in Baghdad

    Salam Pax brings news that his friend ‘G’ has just started a blog. Inside he reveals the current firearms allowance in Baghdad to be one Kalashnikov and one pistol. I wonder if the NRA would accept that kind of compromise?

    The result of one day enforcing this limit in “a sweep on one of the poor neighborhoods on the south tip of Baghdad” ?

    after 8 long hours.…. the Americans left, confiscating 6 antiaircraft heavy machine gun bullets form over than 40 houses.

    [/society] posted at 19:20 #

    Sat, 07 Jun 2003

    Evolutionary Psychology

    One man’s explorations in Evolutionary Psychology contains such gems as :

    Why Pigeons Don’t Know They’re Alive

    If you were designing a creature, would you give it the ability to over-ride good sensible instincts, when that creature is not intelligent enough to guess the likely outcomes of these over-rides? I think not.

    Why Samurai Killed Themselves

    Families, not wishing to be harmed by the actions of one rogue family member, would for the sake of their genes demand that the one erring member should kill himself rather than damage the whole family gene pool.

    … the attitude to suicide amongst the general peasantry was very different. It was considered a crime. A peasant man was valued for his ability to feed his family. Whereas a noble could be confident that someone would look after his children, and that there was no danger of their starving, a peasant was not in this position. A peasant who killed himself would be significantly harming the chances of his children to grow up properly fed. The nobles relied for their income on the labours of the poor in their area, so they didn’t want their peasants killing themselves off.

    Why asking her out is terrifying

    Today, … a man can afford to be rejected almost all the time, so long as some women consent. This was not the world our foraging ancestors lived in. Back then, the world was sparsely populated. A man might live in a band of about twenty-five people, of whom perhaps six at most would be women of reproductive age, and most of these would be spoken for. It would be common that the man would only have frequent encounters with one or two potential mates. A wise designer of human instinct would therefore give men a fear of ‘blowing it’ with such rare and precious women. The maxim ‘There are plenty more fish in the sea’ would be even less of a comfort to a man who knows that he might not set eyes on another single woman for months.

    [/society] posted at 13:32 #

    ESR gets worse

    NTK have been doing a good job recently of covering the excesses of (Open Source uberpimp turned political zealot) Eric Raymond.

    Their latest reveals him abusing his maintainership of the Jargon File to promote his own NeoCon agenda.

    Repeated reading of a second-hand copy of ‘The Hacker’s Dictionary’ (the print edition of the Jargon File) was my introduction to the world of computing, so I have a strong desire to see it properly maintained.

    Fortunately, the File is in the public domain, so:

    … if someone did want to fork the Jargon File, now would be the time to do it. Raymond’s previous googlejuice at tuxedo.org has been cast to the winds. A new, reformatted and popularly linked-to upstart could quickly seize the top Google slot.

    Any takers?

    [/technology] posted at 13:31 #

    Slammer Worm debrief

    Wired’s Slammer Worm debrief is worth checking out for the awesome graphics courtesy of Akamai and Paul Boutin’s ability to evoke an image of a dying internet:

    By 12:45 am, huge sections of the Internet began to wink out of existence. Net Access Corporation, one of the Northeast’s largest ISPs, sent out an early SOS: “Nearly half our ports are in delta alarm right now.” Up on the big screen, Maresh could see backbone carrier Level 3’s transcontinental chain of routers trying to find working paths to the rest of the world - and failing. Three hundred thousand cable modems in Portugal went dark, and South Korea fell right off the map: no cell phone or Internet service for 27 million people. Five of the Internet’s 13 root-name servers - hardened systems, all - succumbed to the squall of packets.

    [/technology] posted at 13:31 #

    Wed, 04 Jun 2003

    Geocaching

    It seems I have been failing to pay attention because today was the first I heard of Geocaching and it’s already under attack.

    From geocaching.com’s faq:

    Geocaching is an entertaining adventure game for gps users. Participating in a cache hunt is a good way to take advantage of the wonderful features and capability of a gps unit. The basic idea is to have individuals and organizations set up caches all over the world and share the locations of these caches on the internet. GPS users can then use the location coordinates to find the caches. Once found, a cache may provide the visitor with a wide variety of rewards. All the visitor is asked to do is if they get something they should try to leave something for the cache.

    It is deceptively easy. It’s one thing to see where an item is, it’s a totally different story to actually get there.

    As for the attack:

    “It’s good, clean, wholesome fun - just do it someplace else,” said Brian Adams, chief of resource protection for the St. Croix National Scenic Riverway, which has banned geocaching.

    As someone without a GPS I can’t really appreciate the appeal but it seems likely to have some merit. The sense of community and reciprocation is warming but probably only exists because of the high cost of entry into the geocaching world. What makes it particularly interesting is that it heralds the start of the descriptive markup of the physical world.

    [/society] posted at 20:33 #

    Tue, 03 Jun 2003

    Bush’s sensible position on Israeli settlements?

    This, from the Washington Post, is via another DeLong: “We need a better press corp” piece so it should probably be taken with a shaker of salt. However, even the implication that the US could force a deal on Israel involving abandoning the settlements surprised me.

    The president has baffled some of his aides with comments they thought minimized the obstacles toward the two-state solution he talks about. For instance, the president has told aides that the Israelis are wasting their money on expanding settlements in the West Bank because ultimately those projects will become housing developments for Palestinians.

    Some aides suggest this is a naive view of the settlement issue, noting that experts on both sides of the issue believe unchecked expansion of the settlements would make it impossible to create a viable Palestinian state. Other Bush advisers say the president’s comments simply reflected his determination to create a Palestinian state.

    [/politics] posted at 19:07 #

    Salam Pax on Baghdad’s tech recovery

    Good update on the state of technology in Baghdad from Salam Pax:

    The old state owned Internet center in Adil district has been taken over by anarchists and they are offering internet access for FREE. You just need to dial up a number, no password, no special settings. Whoever heard of anyone doing that?

    Baghdad will also be getting its first GSM network in about two weeks. A couple of thousand lines as a first step, mainly for NGOs and Administration. I think it is going to be MCI who will set this up.

    via: Due Diligence

    [/technology] posted at 10:22 #

    Sun, 01 Jun 2003

    In brief

    Something I had long given up hoping for: the first signs of a healthily competitive online music business.

    Good to see Franks already working hard on his legacy: How Tommy Franks won the Iraq war

    Swarm crime could be the killer app to drive a more even distribution of technology.

    US army continues attempts to seduce geekish doves.

    [/misc] posted at 11:35 #

    Simulations

    The title: “The Simulation Argument: Why the Probability that You Are Living in a Matrix is Quite High” is strange as the first paragraph directly contradicts it: “The Matrix got many otherwise not-so-philosophical minds ruminating on the nature of reality. But the scenario depicted in the movie is ridiculous: human brains being kept in tanks by intelligent machines just to produce power.”

    Nevertheless, this is interesting stuff.

    Now we get to the core of the simulation argument. This does not purport to demonstrate that you are in a simulation. Instead, it shows that we should accept as true at least one of the following three propositions:

    (1) The chances that a species at our current level of development can avoid going extinct before becoming technologically mature is negligibly small

    (2) Almost no technologically mature civilisations are interested in running computer simulations of minds like ours

    (3) You are almost certainly in a simulation.

    These arguments assume finite computational power. If you also consider the possibility of infinite computational power and infinite storage (a real stretch, I know) then simulations could be recursive. The probability of being in a simulation becomes even higher and our ‘God’ is also probably in a simulation.

    Via Slashdot

    [/society] posted at 11:34 #

    Palm WiFi

    Palm look like they have a clue:

    The Tungsten C is Palm’s first handheld with Wi-Fi built in.

    Then show that they don’t:

    The Tungsten W is a combination phone, organizer and e-mail device and shares a similar design with the Tungsten C. Instead of a Wi-Fi radio chip built in, though, it has a GSM/GPRS (Global System for Mobile Communications/General Packet Radio Service) chip so it can access cellular networks.

    Instead of?

    [/technology] posted at 11:31 #

    Thu, 29 May 2003

    Brief Links

    Studies of virtual worlds expand from economics to law.

    The “gaming console as razor - games as blades” model doesn’t look quite so clever when people start building super computers out of them.

    Snow Crash looking a bit too distant? Why not contribute?! Buy this and start floating it round the Pacific rim.

    WiFi chips $6.50 by Q1 2004. $4 later that year.

    [/misc] posted at 23:09 #

    China jails 4, tortures 1 for e-subversion

    Well, the Chinese government doesn’t mess around when dealing with those evil pro-democracy subversives.

    The Beijing Intermediate People’s Court sentenced geologist Jin Haike, 27, and Xu Wei, a 28-year-old journalist for Beijing’s Consumer Daily, to 10 years each in prison. Yang Zili, a 31-year-old computer engineer, and Zhang Honghai, a 29-year-old freelance writer, were each given eight years.

    One of the men sentenced on Wednesday, Xu Wei, told the court he had been brutally beaten and tortured with electric shocks to his genitals, according to campaign group Human Rights in China. The former journalist had to be carried out of the court after he struck his head on the judge’s desk and was knocked unconscious, the group said.

    [/society] posted at 23:09 #

    Weblogs in Organisations

    Phil Windley and Phil Wolff are asking some good questions about potential roles and details of organisational blogging.

    [/technology] posted at 23:08 #

    India and Germany swing to OSS

    Looks like Microsoft’s “Stop Linux at all costs” slush fund was too little to win either India:

    President A P J Abdul Kalam on Wednesday urged Indian IT professionals to develop and specialise in open source code software rather than use proprietary solutions based on systems such as Microsoft Windows.

    He said that during a discussion with Microsoft CEO Bill Gates at the Rashtrapati Bhavan a few months ago, he had discussed the issue of software security and the need to look for open source codes. “Our discussions became difficult since our views were different,” Kalam said.

    or Germany:

    The city of Munich said on Wednesday that it would switch 14,000 computers from Microsoft’s Windows operating system to rival Linux.

    The Munich decision comes as the German government is installing Linux throughout certain ministries and public institutions.

    In the northern state of Lower Saxony, 11,000 police computers will be switched from Microsoft Windows to Linux from next year, according to the interior ministry.

    This is probably just the tip of the iceberg. Maybe Gates will bankroll a internationally palatable presidential candidate in 2004.

    With thanks to my gracious hosts

    [/technology] posted at 23:08 #

    Wed, 28 May 2003

    Apple start to bow to the RIAA

    Cory Doctorow’s anger at Apple reminds me of another reason I use Free Software: I don’t like feeling betrayed.

    Apple has removed a useful feature from its software, and its customers are out in the cold. I paid $50 or so for downloadable iTunes tracks, with the understanding that Apple had sold me something that would stream over the Internet. Yesterday, they had. Today, they took it away. And they called it an “enhancement.” As Winston Smith said to O’Brien, “Don’t feed me shit and tell me it’s Victory Gin.”

    [/technology] posted at 01:44 #

    More thoughts on WiFi enabled phones

    I’ll keep banging the drum because the disruptive potential of WiFi/GSM phones is huge and I’m yearning for one.

    They are coming:

    Mayhew-Begg said that by the end of the year, the first Nokia phone with WiFi as well as GSM would be launched.

    Hughes said that the fears of power consumption being high on WiFi phones were unjustified. “My understanding is that the only difference in power consumption between WiFi and Bluetooth is the range. So with power control added to WiFi, you can get similar power consumption.”

    … fingers crossed.

    Voice over IP over WiFi has early adoptors outside of businesses. (Apple co-founder) Woz recently moved house just to get a GSM signal. Others would adopt for a cheap-open (if patchy) 3G equivalent, with universal remote control and point of presence as co-motivators.

    Tariff avoidance is the mass-market adoption motivator and is powerfully viral (“You have unlimited texting and landline calls from here, work and college?! How?!”). It should also drive home WiFi/broadband adoption and public hotspot demand. The market for Hotspot in a Box products should be massive.

    Winners:

    • WiFi vendors
    • Mobile phone manufacturers
    • Broadband providers
    • VoIP providers
    • Sociable people

    Losers:

    • GSM network providers
    • 3G license holders
    • Traditional landline providers

    Just another TelCo misery story.

    [/technology] posted at 00:28 #

    Tue, 27 May 2003

    Stanton Warriors in Oxford this Thursday

    Awesome breakbeats at PONANA: details

    [/misc] posted at 23:42 #

    Mon, 26 May 2003

    A message for our less creative programmers

    Did you make a killing fixing decades old COBOL programs for Y2K? Were you planning to live off the cash, build up your Unix and C skills just in time for the fun that 2038 is sure to bring?

    Well, why wait until then?! From 2005 :

    … the Uniform Code Council (UCC) will no longer support the UPC-12 barcode standard that is almost universally used in North America. This is because the UCC, which controls company identification numbers that are part of the UPC-12 symbology is running out of numbers to fit in the 12-digit format.

    The UCC has issued a joint recommendation with its European and Japanese counterparts to fix the problem using a 14-digit standard of the same symbology.

    Quick, you still have time to swat up on Point of Sales systems!

    via Adam Curry

    [/technology] posted at 16:03 #

    Skylinc - balloon based wireless broadband for rural Britain

    It requires a directed dish so is not mobile, but it’s potential to offer 10MB/s anywhere should still shake up the broadband market.

    The BBC have a piece but Skylinc’s website is much richer on info:

    Each LIBRA super-cell has a MASSIVE coverage of 2,000 sq miles (equivalent coverage of up to 2,000 traditional wireless base stations)

    87% of UK SME business locations will be accessible from only 18 LIBRA platforms

    It looks like it was specifically developed to solve the problem of getting rural businesses online:

    SkyLINC’s product development has been funded by UK Government Department of Trade and Industry grants and private US aerospace investment.

    [/technology] posted at 15:21 #

    Sun, 25 May 2003

    Oil Corruption

    An Economist article on how badly countries tend to handle mineral wealth and how accounting disclosure rules (“Publish What You Pay”) for big oil companies should help third world development.

    The Publish What You Pay folks look like something quite rare. Well thought out, realistic, targetted activism.

    [/society] posted at 17:33 #

    Notes on (the Politics of) Eurovision

    I’ve come to the conclusion that the Eurovision Song contest is worth watching at least once every few years, as long as you follow three rules:

    1. Skip all the songs and only tune in for the voting.
    2. Pretend the singing never even took place.
    3. Ensure someone with half-decent knowledge of European geography, history and politics is present.

    Most of the songs are so bad that and the public’s bias so strong that the only way to explain much of the voting is in the context of political history. This is widely discussed inside of Europe but is probably missed by those looking in.

    Time have an article from last year:

    This “is the continuation of European wars by peaceful means,” says Jurgen Meier-Beer of Germany, who is on the committee overseeing the show.

    Gilles Renault, music critic for Liberation. “It’s more of a joke than anything else.” Britain, at least, knows to laugh. In fact, people throw parties to enjoy what Terry Wogan calls “sublime awfulness.”

    There is also a more comprehensive statistical analysis:

    … voting patterns tended to break down into three blocs: a Western Bloc (England, Ireland, France, Holland, Belgium and Luxembourg), a Northern Bloc (the Scandinavian countries plus Germany) and a Mediterranean Bloc (Turkey, Italy, Spain, Yugoslavia, Greece and Cyprus.) Each was far more likely to vote for countries within its bloc than for those outside it. And as a rule of thumb, the further away countries are, the less likely they are to give each other points.

    If you get bored of watching it from this perspective you can also consider the possibility of bribery and which countries would care enough - about the potential positive PR - to do it.

    [/society] posted at 14:18 #

    Moving Google with your eyes

    I think Jeremy Zawodny is jumping the gun - he admits the possibility himself, but I like unusual adaptions of Heisenberg’s Uncertainty Principle too much for that to count against him.

    Google has a really hard problem to solve. It’s not unlike the Heisenberg Uncertainty Principle. PageRank stopped working really well when people began to understand how PageRank worked. The act of Google trying to “understand” the web caused the web itself to change.

    More Blogosphere-Gaining-Self-Awareness going on as Kalsey
    deconstructs his recent popularity.

    [/technology] posted at 14:17 #

    More open content

    Free (although very experimental) music over at Opsound.

    This is via an interesting article over at Creative Commons to promote alternate copyright licenses.

    I’m listening to this right now and it’s ambient city noise. Literally. It could be relaxing.

    [/misc] posted at 00:28 #

    Sat, 24 May 2003

    Useless trivia from museums #1 - Oxford Museum of Science

    The Oxford Museum of Science currently have a “Horological Masterworks” exhibition from which I learnt about Roman Striking clocks.

    These are ingenious devices which can produce 3 different sounds, each sound representing X, V or I. This allows the clock to chime the hour in Roman Numerals. They can be visually identified because they use IV as 4 instead of the near universal (for clocks) IIII.

    [/misc] posted at 13:57 #

    Thu, 22 May 2003

    The tech it took to take Baghdad

    Joshua Davis describes “a dazzling array of technology that signals the arrival of digital warfare” in his awesome Wired article on the tech it took to take Baghdad.

    Caddell sketches out a typical scenario: A Special Forces unit in northern Iraq attacks an Iraqi irregular unit. The firefight is recorded with digital video, which is uploaded to GCCS via secure satellite. JOC intelligence officers fire up the Warfighting Web, click through to “Latest Intelligence,” watch the fight, write a summary, and post follow-up orders to the unit. The soldiers either download the orders directly or receive them by radio from the nearest Tactical Operations Center, the most forward command post on the network.

    They’re using Microsoft Chat!?

    “What’s funny about using Microsoft Chat,” he adds with a sly smile, “is that everybody has to choosean icon to represent themselves. Some of these guys haven’t bothered, so the program assigns them one. We’ll be in the middle of a battle and a bunch of field artillery colonels will come online in the form of these big-breasted blondes. We’ve got a few space aliens, too.”

    How important is the network?

    Lieutenant Colonel Mims: “If it’s a question of the network going down, we get helicopters, air support, tanks - whatever we need”

    It looks slightly different from the trenches:

    There are other problems. “When we were deployed from the States,” says Lieutenant Marc Lewis - the commander of the convoy’s 27 heavy equipment trucks - “they told us that we would be given encrypted, military-issue radios when we got here. When we arrived, they told us we should have brought our own.”

    What Lewis brought was four Motorola Talkabouts, each with a range of about 1,000 feet. In the half-dozen convoy trips he’s made since arriving in country, Lewis has taken to distributing a Talkabout to the first and last trucks. The other two go to vehicles at strategic points in between. It’s hardly secure. Anybody with a radio could monitor the conversations.

    I give up, there’s too much good stuff in there to quote. Read it. Worryingly little thought seems to have gone into what happens when both sides have this kind of technology.

    And Bruce Berkowitz suggests how this can be applied to North Korea, where apparently, they are training hackers.

    [/technology] posted at 08:41 #


    Jason Pellerin faultlessly expands on my Mute/Non-Programmer idea.

    [/technology] posted at 07:53 #

    Iraqi Debt Write Off

    Here’s a good idea from an Economist article about Iraqi debt. Writing off the debt of deposed dictatorships will discourage lending to active ones.

    Some economists, such as Michael Kremer of Harvard University, argue that, after a change of regime, a country’s new government should have no legal obligation to service the “odious debt” of an illegitimate predecessor, an idea dating back to the Spanish-American war of 1898. In theory, establishing the right of a country to write off odious debt would have potentially huge benefits, not least by discouraging banks from lending to nasty governments that might one day be overthrown. Indeed, says Mr Kremer, setting out precise rules for what counts as an “odious regime”, and thereby making it harder for such regimes to borrow, may be a better form of economic sanction than the traditional approach of obstructing trade. Restrictions on trade hurt ordinary people, whereas making it harder to borrow hurts the baddies in charge more directly.

    However:

    As Harold James, another Princeton economist, has argued, this could destabilise the global credit markets by making creditors fearful that other countries might one day describe their debt as odious. It is not hard to imagine circumstances in which, say, a newly democratic China might try to shed the external debt “$170 billion at the end of 2001” of the “odious” undemocratic regime it replaced.

    Still, in the UK, memories of the dodgy arms deals bailed out by the ECGD make me hope it could work.

    [/economics] posted at 06:23 #

    Wed, 21 May 2003

    Labour MP has weblog, will flame

    Labour MP Tom Watson has a weblog and is using it to lay into Tory opponent Bill Cash MP, whose politically sensitive mobile phone conversation he overheard on a Monday morning train.

    Cash retorts in The Mirror:

    “If people are listening in to other people’s conversations - and in my view misinterpreting them - then I think that’s a very great shame.”

    Which annoys Watson:

    No, no, no Mr Cash you can not get away with that. You know I didn’t misinterpret anything. Continue down this road and I will have to reveal the rest of the conversations we all had to endure. In fact I might do anyway.…..

    If this is anything to go by, the next election is going to be fun.

    [/society] posted at 10:37 #

    Nokia commit to WiFi

    This is the first public commitment Nokia have made to WiFi. It’s not much but at least shows they’re not going to be blindsided.

    Donal O’Connell, Nokia phones’ R&D veep, said that WiFi will form a part of its future high-end handsets at an analyst briefing in Irvine, Texas today.

    802.11 will be an option, he told us, but just another option. That doesn’t mean that WiFi will be used for handling voice calls, however.

    I have a recent Series 60 Nokia (the 7650 - I’m very happy with it). The platform is open enough that if it had WiFi and somebody released a Voice over IP/WiFi application for it, there’s nothing Nokia would be able (or logically would want) to do. I read that last statement as an attempt to pacify the networks - who are the real losers here.

    Clay Shirky’s Permanet, Nearlynet, and Wireless Data is a good starting point for this.

    [/technology] posted at 08:49 #

    Blogs and Wikis

    I’ve been doing a fair bit of thinking about how to increase the crossover between blogs and wikis. Joi Ito started me off so he should find this interesting.

    Blog to Wiki

    Each blog post should be automatically injected into it’s own wiki page. These pages should be alterable only with the approval of the original author. Changes by anyone else would be queued for the author’s approval and automatically applied if approval is granted. This would allow corrections to be made while preserving the original historic record.

    Each weblog entry could now be accompanied with a “correct this entry” button and if appropriate a “view corrected version” button.

    The wiki page can show the author’s current (under)standing with the blog showing his original post on the subject.

    WikiWords appearing in a weblog post should be automatically converted to links to the correct wiki page.

    Wiki to Blog

    The only way I could imagine this working is to have have wiki changes presented as either part of the blog or down a sidebar. If this is a personal blog, only that person’s changes should be shown.

    The key to making this work is attractive presentation and intelligent aggregation.

    If these changes are presented in an attractive enough way, skimming should allow one to intuitively pick up the level and kind of activity occuring on the Wiki (and by extension the project). For a group blog, daily aggregation of changes, per author, may be required to reach a satisfactory level of browsability.

    These pretified changes should, of course, be offered as RSS alongside the weblog’s feed. In fact, this is a good example of an alternative use of RSS.

    [/technology] posted at 02:36 #

    When editors attack

    I don’t know how much of Greg Palast’s “The Best Democracy Money Can Buy” has been mutilated, but the page that I happened to open it on had “September 11, 2002” replacing “9/11”. Now I don’t have the motivation to read it, I know I’d be fact checking all the time.

    Compare:
    Page from Greg Palast's TBDMCB
    and his version.

    On my BBC television show, Newsnight, an American journalist confessed that, since the 9/11 attacks, U.S. reporters are simply too afraid to ask the uncomfortable questions that could kill careers

    [/media] posted at 01:19 #

    Heh, I’m not invisible

    Flattering to think I could make Brad Delong’s brain explode.

    Wow! My brain explodes. Not in a bad way, you understand. In a good way. Stuart Robinson (who is he?) goes live with his weblog. How can he know about so much good stuff that I have missed?

    Is quoting myself equivalent to talking to myself? :

    I’ll try to get an ‘about’ page up, the apparent anonymity is just from a lack of time. Abridged: British, based in Oxford, not at ‘Oxford’, soon to graduate. Reads too much.

    [/meta] posted at 00:34 #

    Tue, 20 May 2003

    Recursive blogging

    One thing I’m learning is that no matter how much you intend not to, you end up blogging about blogging. Doing it makes total sense now, but from the outside always seemed self-obsessed.

    With that in mind, here is a piece from Microdoc news that thinks it’s own popularity is likely:

    The stories that get going are not usually subject specific blogs but stories that cut across all interests of the blogging community. A medical, technical, or other type blog does not make it big, for example. But stories about blogging, human rights, world events, or the human spirit that apply to everyone, tend to become big stories.

    There’s a lot more good stuff in there.

    [/technology] posted at 23:44 #

    Hello

    OK, finally. After what looks (in the calendar) like an age and felt like an eternity, my weblog is live.

    I’m still not convinced choosing blosxom over Movable Type was wise. But the plugins rock and at least RMS won’t hunt me down.

    Now all that’s left to do is:

    • Learn how to write coherently
    • Produce a nice design in CSS
    • Fill up the sidebar with little hacks to make me look clever
    • Standards validation
    • RSS 1.0 and 2.0

    and I’m ready to take on the world.

    [/meta] posted at 12:13 #

    Mon, 19 May 2003

    Corporate computer security consulting still sucks?

    Interesting idea from Charlie Stross.

    My experience of large consulting companies is that their analysts are more focussed on the appearance of professionalism than on the substance, more interested in looking trustworthy to the occupants of the boardroom — walking the management walk, talking the management talk — than in actually doing the job.

    Structures. Human organisations that are fundamentally defective at the job in hand but that are more successful than competent organisations in the market because they’re better at winning contracts. Predictability and security. (Is that an itch in my fingertips? I can feel a story coming on …)

    That means that the real problem lies in the companies hiring consultants. If security becomes important enough then companies will be forced to consult the competent or be hacked to death.

    “I don’t care how nice those guys are or how many meals they took us out on. If we get robbed by hackers again, I get fired. Hire the guys with the dodgy beards”.

    [/technology] posted at 15:21 #

    EasyCinema

    EasyJet’s Stelios Haji-Ioannou pushes his yield management techniques into the cinema industry:

    It’s a novel system because it depends on the price incentive. At the moment, there is no incentive to book early; it’s entirely untested. But if you make it blatantly obvious that people who book early will pay much less, that can only be attractive. Commit now and it’s 20p. Come back in a week’s time and it’s a pound. Turn up on the evening of the show and it will be five pounds.

    And runs into the MPAA (or their UK lapdogs):

    I’ve promised them that I will remove the risk to their revenue by paying them a lump sum, somewhere between a few hundred and a few thousand pounds, to screen their releases; that way they get paid even if I turn out to be incompetent. But they’re not budging; they believe that when their $200m blockbuster can be seen for 20p, it cheapens the product.

    … it may transpire that what they are doing is illegal. They can’t tell me how much to charge the customers.

    This kind of pricing scheme can be taken a long way. How far depends on how people can adapt to it, not on the technology underpinning it.

    [/economics] posted at 15:01 #

    New wifi cards work on any frequency = no Linux drivers

    This gives us a preview of the major shitstorm that software radio is going to cause.

    [/technology] posted at 15:00 #

    South Korea: a futurologist’s wet dream

    Want to see what 70% broadband adoption does to a society?

    Korea tells you:

    But only gives you a taste of your future.

    [/technology] posted at 12:50 #

    Microsoft licenses Unix IP from SCO

    Coincidentally at the same time as SCO are suing IBM to stop Linux. Microsoft are a company capable of learning and adapting. What they learnt from the antitrust trial seems to be ‘get someone else to do your dirty work’.

    Late Sunday, Microsoft general counsel Brad Smith said acquiring the license from SCO “is representative of Microsoft’s ongoing commitment to respecting intellectual property and the IT community’s healthy exchange of IP through licensing”.

    Is he trying to imply something?

    [/technology] posted at 11:22 #

    Sun, 18 May 2003

    You can take my money but you can’t take my grades

    Sometimes D-Squared is good:

    If there was a revolution tomorrow then my binman would presumably still be in his old job, but Warren Buffet would be looking at a seriously reduced standard of living. So Warren Buffet ought to pay more than my binman for the cause of keeping the proles contented.

    And sometimes he’s awesome:

    I suspect that the class would agree to some sort of progressivity in the redistribution schedule, but not as much as they might suggest for the marginal rate of income tax. The difference between the answers would be a useful quantitative measure of exactly how hypocritical left-wing students are, a question that I suspect a lot of us would be mildly interested in.

    [/economics] posted at 11:16 #

    LifeLog, from the people who brought you ARPANET

    One good thing about having a (AWOL) fighter pilot in the White House - DARPA has a ton of money again.

    This project appears to be an attempt to create the kind of intelligence computers will need to be able to make sense of all the data of an individual’s life. The ultimate PA and PH (personal historian).

    [/technology] posted at 10:52 #

    RFID tag + mobile phone = credit card
    That IBM ad where the guy in the trenchcoat looks like he’s shoplifting but is actually paying wirelessly (hoho!) is now more than an ad.

    [/technology] posted at 09:46 #

    Intranet weblogging at Google

    Interesting. How long until “x years blogging experience” appears on job adverts?

    [/misc] posted at 08:58 #

    Sat, 17 May 2003

    WiFi phones in use

    Fortune article titled “This Is Not a Cellphone”.

    At 27 of Group Dekko’s 30 locations around the country, managers and supervisors use special handsets to make and receive voice calls on the same wireless broadband network the company uses for Internet access. The calls are converted to Internet Protocol data “packets.” They essentially travel for free as long as they stay on Group Dekko’s wireless intranet.

    So why not marry the two technologies (WiFi + GSM)? In fact, Motorola, Proxim, and Avaya are jointly developing handsets and gear that will let callers roam between the two types of wireless networks. By the end of the year the companies will begin testing phones that run voice over Wi-Fi in the office and voice over cellular on the go.

    This is what’s going to kill 3G and strip most of the profit out of being a mobile GSM network provider.

    [/technology] posted at 10:48 #

    Thu, 15 May 2003

    Cuba was part of the developed world in 1957

    Brad DeLong offers excellent counterpoints to those who have (economically - at least) tried to give Castro some credit.

    The hideously depressing thing is that Cuba under Battista—Cuba in 1957—was a developed country. Cuba in 1957 had lower infant mortality than France, Belgium, West Germany, Israel, Japan, Austria, Italy, Spain, and Portugal. Cuba in 1957 had doctors and nurses: as many doctors and nurses per capita as the Netherlands, and more than Britain or Finland. Cuba in 1957 had as many vehicles per capita as Uruguay, Italy, or Portugal. Cuba in 1957 had 45 TVs per 1000 people—fifth highest in the world. Cuba today has fewer telephones per capita than it had TVs in 1957.

    You take a look at the standard Human Development Indicator variables—GDP per capita, infant mortality, education—and you try to throw together an HDI for Cuba in the late 1950s, and you come out in the range of Japan, Ireland, Italy, Spain, Israel. Today? Today the UN puts Cuba’s HDI in the range of Lithuania, Trinidad, and Mexico. (And Carmelo Mesa-Lago thinks the UN’s calculations are seriously flawed: that Cuba’s right HDI peers today are places like China, Tunisia, Iran, and South Africa.)

    [/economics] posted at 10:55 #

    Apple’s backdoor napster clone

    The theory is that Apple intentionally made iTunes transparent enough that semi-legal file sharing systems could be built around it. Hopefully sidestepping legal problems.

    Apple could be the first company to understand how open, commercial and underground code can be combined to benefit their customers and their own bottom line.

    The next test comes when the Apple have to decide how to deal with iTunes clones and unofficial iTunes Music Store clients. If they wield the DMCA they will lose the faith of many.

    [/technology] posted at 10:02 #

    Wed, 14 May 2003

    Romero developing for the N-Gage

    Slashdot brings news from E3 that Doom and Quake co-creator John Romero is developing for Nokia’s new gaming oriented phone.

    In the long term the mobile phone will destroy the Gameboy, and with Sony looking to enter this market, Nintendo should be looking for a new revenue stream.

    [/technology] posted at 10:39 #

    IT goes golden or grey?

    Interesting Economist article about IT leaving it’s exponential roots behind and ‘just working’. I read somewhere that this is actually regurgitated Oracle PR but I’m a sucker for slick historic parallels, so:

    When Britain’s railway mania collapsed in 1847, railroad shares plunged by 85%, and hundreds of businesses went belly-up. But train traffic in Britain levelled off only briefly, and in the following two decades grew by 400%.

    Brad DeLong, an economics professor at the University of California at Berkeley, puts it somewhat more succinctly: “I am optimistic about technology, but not about profits.”

    [/technology] posted at 07:26 #

    Tue, 13 May 2003

    Amazon.com actually very healthy

    Damn, while I was waiting for them to die, Bezos was doing a really good job sorting them out.

    [/economics] posted at 09:33 #

    Mon, 12 May 2003

    Sub-City Tunnelling

    Here’s something from last month’s Wired that I missed. The emergence of tunnelling technologies that appear to make underground suburbs (underburbs?) economically inevitable.

    You won’t hear much talk of it outside of specialized engineering circles, but we’re at a tipping point. The cost to burrow down is dropping, while the price (and hassle) of erecting a skyscraper in a dense urban area just keeps rising. The breakthrough comes thanks to tunneling technologies that are now being used on huge transportation projects, like Boston’s Big Dig and Moscow’s Lefortovo highway tunnel project. Over the next 10 years these techniques will be used to hollow out space beneath the world’s great cities.

    [/technology] posted at 17:46 #

    Stanford’s 1k page/hr book scanning robot

    Fantastic milestone on the way to universal digitisation of the world’s knowledge.

    For Mr. Keller the most vexing challenges are neither labor costs nor technology. Librarians, he said, must find a way to address the copyright restrictions that appear to be tightening as a result of new federal laws like the Digital Millennium Copyright Act of 1998.

    And people wonder why there are so many libertarians on the Internet.

    Another project, led by the Internet Archive in San Francisco, recently shipped 80 tons of old books acquired from the Kansas City Library to Hyderabad, India, where they will be scanned, according to Michael Lesk, a former National Science Foundation official and digital library expert who works with the archive.

    Excellent.

    [/technology] posted at 14:00 #

    Fri, 09 May 2003

    Closet fark photoshopper interviewed

    Former Los Angeles Times photographer Brian Walski is interviewed about his fake Iraq war photo.

    And the Internet thing, that’s hard to deal with. I did a Google search on my name, and it comes up in about 25 languages. Every photographer wants to be known for a picture he’s taken. I’ll be known for this.

    Chalk up another old media worker’s education as complete.

    [/media] posted at 16:57 #

    Thu, 08 May 2003

    Source to commercial album available

    I dislike old man rock as much as anyone my age, but Marillion are showing us a fleeting glimse of a more open music production method.

    [/misc] posted at 12:05 #

    Wed, 07 May 2003

    Decentralised security camera watching

    Another sighting of the transparent society on the horizon.

    [/technology] posted at 11:05 #

    Social skills first developed to enable large game hunting

    Meat eating as the basis of civilisation. Vegetarians declared 'Untrustworthy'.

    [/society] posted at 08:55 #

    What happens when the future starts to evenly distribute

    Pre-natal scans look set to - in the long-term - indirectly solve India’s overpopulation and women’s rights problems.

    [/society] posted at 08:43 #

    Tue, 06 May 2003

    BBC continues to defy logic by being good

    BBC shows interest in becoming enabler in addition to broadcaster.

    [/media] posted at 13:38 #

    Stalinesque photoshopping in Evening Standard

    Sometimes, the anachronisms come from the wrong direction.

    The source of the image is footage from the BBC. The Standard’s paperboys were obviously allowed to clone and blur the image in numerous ways to make it look like a gigantic crowd.

    [/media] posted at 11:43 #

    Thu, 01 May 2003

    SARS 1.0 Released

    Today’s head fuck: being able to download the sequenced SARS genome.

    ATATTAGGTTTTTACCTACCCAGGAAAAGCCAACCAACCTCGATCTCTTG
    TAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTAGCTGTCGCTCGGC
    TGCATGCCTAGTGCACCTACGCAGTATAAACAATAATAAATTTTACTGTC
    GTTGACAAGAAACGAGTAACTCGTCCCTCTTCTGCAGACTGCTTACGGTT

    [/technology] posted at 20:36 #

    Iranians blog for freedom

    Looks like Iran could be the first country to geek it to freedom.

    … the underlying Catch-22 here. Bloggers are under the radar of the hard-liners, and that gives them unprecedented freedom. Losing a prominent voice like Motallebi’s is a blow to the community, but losing Net access would be an even more devastating blow. So while bloggers are asking for his release, they hope for the attention of human rights groups, the mainstream press and objective voices — not the saber-rattling of some ideologues.

    Jarvis for one, envisions a future without fear. “Eventually, all but the most Stone Age governments will have to let the Internet in because it has become the price of doing business in the world, and with it comes access to information and the ability to publish to the world (at no cost, with no expertise). The tools of publishing and broadcasting are coming into the hands of the people, and that will make a difference in the world.”

    Preach it!

    [/media] posted at 18:11 #

    Tue, 29 Apr 2003

    Big Brother prefers WiFi

    The Transparent Society gets closer. How long before those CCTV WiFi signals become hacked? How long before people realise they are better off without a state monopoly on snooping?

    Calling it ‘4G’ nicely twists the knife in 3G too.

    London’s City of Westminster Council is to bring 802.11b wireless networking to the streets of Soho. The scheme, dubbed the Westminster 4G project, will initially provide Wi-Fi connectivity for council operatives and remote systems.

    Other applications the Council is considering include the roll-out of greater CCTV monitoring - at a fraction of the cost of current systems which have seen the Council spend around £2 million installing just 30 cameras in the West End

    [/society] posted at 11:11 #

    Sun, 19 Jan 2003

    Open Code and Free Speech

    I use almost exclusively open source software. There are many reason for this, the most important being my intolerance of unjustified crapiness (if my computer is pissing me off I want an excuse and a solution).

    Another major advantage of open code is the ability to audit the code. Now you can check that, for example, your computer is not CCing your emails to the FBI or your plan(s) for world domination to Bill Gates. Except that unless you’re a programmer, you won’t understand the code and therefore you can’t.

    So where is the benefit for non-programmers? A slightly bizarre comparision I like is to a mute man choosing which country he should claim asylum in. He can’t speak so what use is freedom of speech to him? Others will speak for him, helping to ensure his liberty. Others will audit code for you, helping to ensure your security.

    [/technology] posted at 14:41 #

    Wed, 15 Jan 2003

    The dragon and the crack screen

    While wandering around other bloggers archives - in a vain (as in unsuccessful) attempt to find others struggling, as I am, to find their writing feet - I ran across the wonderful first article of Mark Pilgrim.

    It contains the following beautiful and ironic observation:

    Sonys and Broderbunds of the world, pay attention: the only long-term effect of copy protection is to ensure that those who defeat it are immortalized. Long after my Playstation console falls apart, long after all the original, legitimate, uncopyable Playstation discs have crumbled into dust, long after the no-doubt-teenager who cracked Spyro 3 has grown up and joined polite society and found better things to do with his time, Spyro the Dragon will be remembered. Unfortunately, it will also be associated with that damn ugly crack screen, because no other versions will exist. This is what the past will look like someday. And we’ll just shrug, skip intro, and get on with it.

    [/technology] posted at 21:09 #

    Tue, 14 Jan 2003

    Stopping Gun Gangs in Britain

    Gangs and guns are big news here in the UK after some recent high profile shootings. The argument is usually a dichotomy of “re-arm the innocents” vs “disarm everybody”, and personally I tend to side with the former.

    However, this article shows a practical solution. Most of it makes sense, we’re not dealing with criminal geniuses.

    It’s always worth remembering that the fuel behind the whole situation is drug prohibition, but I don’t have time to rant about that right now.

    [/society] posted at 10:56 #

    Annotation, the Bible and the public domain

    The use of hypertext in centralised, non-intrusive annotation projects is a very valuable one. It is also something that clearly demonstrates the value of a large and digital public domain. Annotated hard-copy is, in comparison, slow, clumsy and limited in it’s uses.

    The Skeptics Bible is a project that makes use of hypertext in exactly this way. Its focus on one specific document makes it different to most other annotation projects.

    While writing this is has become obvious to me that weblogs are a decentralised citation system. What would a map of social software, with x-axis as citation-annotation and y-axis (de)centralisation look like?

    [/technology] posted at 10:18 #

    New Zealand Leads the Way

    We all know farm subsidies are a disgrace, but how many knew that New Zealand has almost none.

    The buycott idea espoused in the Spectator link above is also a good one. Although it possibly conflicts with my scheme to buy from poor EU countries, the plan being that it will reduce their subsidies in the long-term. Maybe I have been thinking backwards…

    via samizdata

    [/economics] posted at 10:17 #

    US traditionalism

    The map included in this article is fascinating. An animated version would be awesome.

    via Z+Blog

    [/society] posted at 10:01 #